ID: 1079495953

View in Genome Browser
Species Human (GRCh38)
Location 11:21044299-21044321
Sequence CTTATCAGGAGGTCTGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079495953 Original CRISPR CTTATCAGGAGGTCTGTTGC TGG Intronic
900240336 1:1614262-1614284 CTTGTGAGGAGGCCTGCTGCAGG - Intergenic
904441740 1:30536201-30536223 CATGGCAGGAGGTCTGCTGCAGG - Intergenic
905348717 1:37329624-37329646 CTTGTCAGGATTTCTGATGCAGG + Intergenic
912334534 1:108850002-108850024 CTTGTCACCAGCTCTGTTGCTGG + Intronic
917533059 1:175854367-175854389 TTTTTTAGGAGGTCTGTTGGGGG + Intergenic
1074587459 10:114782211-114782233 CTTAGCATGAGGCCTGGTGCAGG - Intergenic
1076334400 10:129695844-129695866 CTTATCAGGTGCTCTGCTTCTGG + Intronic
1077234814 11:1475642-1475664 CATATCAGGGGGTCCCTTGCTGG + Intronic
1078676205 11:13416871-13416893 CTACTCAGGAGGTGTGTGGCAGG + Intronic
1079458651 11:20660207-20660229 CCTTTCAGGAGCACTGTTGCTGG - Intergenic
1079495953 11:21044299-21044321 CTTATCAGGAGGTCTGTTGCTGG + Intronic
1079858814 11:25641788-25641810 TTTATCAGGATGTCTGTTAGTGG - Intergenic
1081483201 11:43507633-43507655 CTAATCAGGAGATCTGTGGGTGG + Intergenic
1085702336 11:78756309-78756331 TTTATACGGAGGTCTGTGGCAGG - Intronic
1086319883 11:85634428-85634450 CTGATTAGGAGGATTGTTGCAGG - Intronic
1092403266 12:8196015-8196037 CTTGTCATGAGCTCTGCTGCTGG - Intergenic
1096272339 12:50175249-50175271 CTACTCAGGAGGTCTGAGGCAGG + Intergenic
1097138938 12:56883162-56883184 CTTAGCTGGATGTGTGTTGCAGG - Intergenic
1101915548 12:108893026-108893048 CTTTTGAGGAGGTGAGTTGCAGG + Exonic
1106076020 13:26461865-26461887 CATATCAGGAGGTCTGGAGTGGG + Intergenic
1108786307 13:53906088-53906110 GTTATCAGGATGTATGTTGATGG + Intergenic
1110126566 13:71950361-71950383 CTTATCAAAAGATCTGTTTCTGG - Intergenic
1113827413 13:113267630-113267652 CTTATCCGAAGGCTTGTTGCTGG - Intergenic
1122238206 14:100344843-100344865 CTTCTCAGGCGGGCGGTTGCCGG - Intronic
1128482489 15:68052055-68052077 CTGATCTGGAGGCCTGATGCAGG - Intergenic
1130168058 15:81483448-81483470 CTTCTCAGGAGATGTGGTGCAGG + Intergenic
1131729563 15:95265340-95265362 CTTATCAGGAAGCCTTGTGCAGG + Intergenic
1136191872 16:28621670-28621692 TTTATCAGAAGGTCTGTGCCTGG - Intronic
1137485569 16:48887749-48887771 CTTTACAGGAGGGCTGTTGAAGG + Intergenic
1138978658 16:62240115-62240137 CTTCTCAGGATTTCTGTTGTTGG + Intergenic
1141895305 16:86955364-86955386 CTTCCCAGGAGGCCTGGTGCTGG - Intergenic
1143901293 17:10176661-10176683 CTTCTCAGTAGGGCTGCTGCAGG - Intronic
1144096881 17:11907799-11907821 CGTATCTGGAGGGCTGGTGCTGG - Intronic
1144667574 17:17112395-17112417 CGTATCATGAAGTCTGTGGCAGG + Intronic
1147722957 17:42550017-42550039 CTTCTGTGGAGGTCTGGTGCAGG + Exonic
1147724169 17:42556244-42556266 CTTCTGTGGAGGTCTGGTGCAGG + Intergenic
1148480626 17:47957469-47957491 CTCAGCAGGAGCTCTGTTGGAGG + Intronic
1149981443 17:61314496-61314518 GTCATTAGGAGGGCTGTTGCAGG - Intronic
1150533142 17:66006832-66006854 CTTACCAGCAGGTCTGTAGCGGG - Intronic
1152416904 17:80168592-80168614 CTTATCATGAGGTCTGCTGGAGG + Intergenic
1156473749 18:37393266-37393288 CCCATCAGGAGGTCTGTATCTGG - Intronic
1157735158 18:50041181-50041203 CTTATCAGGAATTCTGAGGCAGG + Intronic
930657216 2:54018243-54018265 CTGATCAGGAGGTCTGAAGTGGG + Intronic
939626130 2:144479752-144479774 CTGAGCAGGGGGTCTGTTGCTGG - Intronic
939677093 2:145085928-145085950 CATATCAGTAGTTCTGTTCCTGG + Intergenic
942005402 2:171694701-171694723 CTTTACAGGAAGTATGTTGCTGG + Intronic
948617964 2:239213624-239213646 CACATCAGGAGTTTTGTTGCTGG - Intronic
1169282432 20:4279031-4279053 CTGACCAGGAGTTCTGTTCCAGG + Intergenic
1173436595 20:43037962-43037984 CTTGTCTGGGGGTCTGCTGCTGG + Intronic
1175712394 20:61231672-61231694 CTAGGCAGGAGGTCTGTTGCTGG - Intergenic
1177276549 21:18919569-18919591 CTTAGCAGGGGGTCAGTAGCGGG + Intergenic
1178523201 21:33303266-33303288 CTTGACTGGAGCTCTGTTGCGGG + Intergenic
1182589235 22:31366052-31366074 CTTATCAGTTGCTCAGTTGCGGG + Intergenic
1184718400 22:46295183-46295205 CTTTTCAGGAAGTATGGTGCTGG + Intergenic
950866772 3:16196032-16196054 CTCATCTGGAGGTCTGTAGTTGG - Intronic
952130783 3:30359848-30359870 AAAATCAGGAGGTCTGTTGAAGG - Intergenic
952441611 3:33336274-33336296 CTTATATGGGGGTCTGTTTCTGG - Intronic
952733679 3:36666372-36666394 CTTGTCTGGAGGTCTGTTTCTGG + Intergenic
956840472 3:73135281-73135303 CTTCACAGTAGGTCTCTTGCTGG + Intergenic
959931986 3:111995083-111995105 TTTTTCAGGAAGTTTGTTGCTGG + Intergenic
960977842 3:123193726-123193748 CTTATCAGGCAGACTGTGGCAGG - Intronic
961727360 3:128940645-128940667 CTTATGTGTAGGTCTGTTTCTGG + Intronic
966892791 3:184419281-184419303 CTTACCAGGAGCTCTGTGTCTGG - Intronic
967130620 3:186467240-186467262 ATTTTCTGGAGGTCTTTTGCTGG + Intergenic
967893971 3:194382397-194382419 GTTGTTAGGAGGCCTGTTGCCGG - Intergenic
973037647 4:45426236-45426258 CTTATCAGGAGGTGTGCAGCAGG - Intergenic
975478942 4:74856484-74856506 CTTATAAGGACATCAGTTGCTGG + Intergenic
977486264 4:97650198-97650220 CATAGCAGGAGGTATGTGGCAGG - Intronic
979798729 4:124878983-124879005 CTAATCAGGATGGATGTTGCTGG + Intergenic
986725907 5:10596316-10596338 CTTATCAGGGGGTGTGAGGCAGG - Intronic
999729956 5:154469236-154469258 CGTGACAGGAGTTCTGTTGCGGG + Intergenic
1005405352 6:25481531-25481553 CATAGCAGGAGGTCAGTTGAAGG + Intronic
1005896837 6:30185883-30185905 CTTAGCAGGAGGCGTGTTCCTGG + Exonic
1010499854 6:76584264-76584286 CTTAACAGGAGGTCTGGAACTGG - Intergenic
1012234225 6:96794150-96794172 CTTATCAGGAGTTCTTTTCTTGG + Exonic
1017398317 6:154028996-154029018 CTTATCAGGGGGACAATTGCTGG + Intronic
1017666816 6:156727429-156727451 TTTATGAGAAGGTCTGTTTCTGG - Intergenic
1019037137 6:169070982-169071004 CTTAGCACGAGGTCTGTGGTCGG - Intergenic
1019349589 7:548179-548201 TTCTTCACGAGGTCTGTTGCAGG + Intergenic
1020202630 7:6092287-6092309 CTACTCAGGAGGTCTGAGGCAGG - Intergenic
1023205673 7:37746846-37746868 CTTTTCAGGAGGCAAGTTGCTGG + Intronic
1024904510 7:54361405-54361427 CTGATCAGTAGGTCTGAGGCAGG + Intergenic
1031088509 7:117325240-117325262 TTTTCCAGGAGGTCTGTTTCAGG - Intergenic
1035309461 7:157955998-157956020 CTCATCAGGATGTCAGCTGCTGG + Intronic
1036272892 8:7323581-7323603 CTTGTCATGAGCTCTGCTGCTGG + Intergenic
1036348458 8:7986767-7986789 CTTGTCATGAGCTCTGCTGCTGG - Intergenic
1036865100 8:12389551-12389573 CTTGTCATGAGCTCTGCTGCTGG - Intergenic
1038583732 8:28771466-28771488 CTTATTAGGTGCTCTGTTGCTGG + Intronic
1039403716 8:37294894-37294916 GTTAGCATGAGGTCTCTTGCAGG - Intergenic
1040398829 8:47026651-47026673 GTTATCAGGATGTATGTTGATGG + Intergenic
1040545504 8:48395675-48395697 CTACTCAGGAGGTCTGAGGCAGG + Intergenic
1041605671 8:59779999-59780021 CTTGTCAGGAAGTCTGTGGCTGG + Intergenic
1042635877 8:70873946-70873968 CTCATCAGGAGGGGGGTTGCTGG - Intergenic
1045541982 8:103095364-103095386 ATTACCATTAGGTCTGTTGCAGG - Intergenic
1046556686 8:115782040-115782062 GTTATCATGAGGTCTGCTGATGG + Intronic
1050494572 9:6227425-6227447 TTTATCAGGAGGGCTGTTCATGG + Intronic
1051234343 9:14982749-14982771 TTTATCAGGAGCTCTTTTTCTGG - Intergenic
1059473487 9:114525053-114525075 CTTTTTAGGAGGTCTGTTCTTGG - Intergenic
1186472654 X:9833502-9833524 CTAATTAGGAGGTCCGATGCAGG - Intronic
1189851750 X:45184591-45184613 ATTATCAAGAGGTCTGTGGAAGG - Intronic
1192323132 X:70108336-70108358 CATTTCAGGAGGTTTGTTGCAGG + Intergenic
1193055784 X:77148518-77148540 CTTATCAGGAAGTCTGGAGGTGG - Intergenic
1194195187 X:90883475-90883497 TTTTTCAGGAGCTCTGTTCCAGG + Intergenic
1194812579 X:98404063-98404085 TTTCTCAGGAGGTCTCTTTCTGG + Intergenic
1195864032 X:109410020-109410042 CTTATCTGGAGACCTGTGGCAGG - Intronic
1196865837 X:120069990-120070012 CTTAACAGGAAGTGTGATGCTGG - Intergenic
1196877259 X:120166290-120166312 CTTAACAGGAAGTGTGATGCTGG + Intergenic
1197340249 X:125257046-125257068 CATATCAGAAGGTTTCTTGCTGG + Intergenic