ID: 1079497652

View in Genome Browser
Species Human (GRCh38)
Location 11:21063967-21063989
Sequence GTGTAGATCTTCTAGGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079497652 Original CRISPR GTGTAGATCTTCTAGGAGAG TGG Intronic
902808547 1:18875493-18875515 CCGAAGATCTCCTAGGAGAGAGG + Exonic
903540513 1:24093727-24093749 GTGTAGATCTTCCAGAATGGAGG - Intronic
906834727 1:49071005-49071027 TTCTAGATTTTCTAGAAGAGAGG + Intronic
906842141 1:49150844-49150866 GTGTAGAACTGATAGGAAAGAGG - Intronic
910030124 1:82709789-82709811 GTGAAGTTTTTCTAGGAGTGGGG + Intergenic
913347237 1:117820747-117820769 GTGCAGATACTCTAGGAGATGGG - Intergenic
918117555 1:181509967-181509989 GTGCAGAGATTCTAGAAGAGAGG + Intronic
918439612 1:184553752-184553774 GGGTAGACCTTCTGGTAGAGGGG - Intronic
923235495 1:232029207-232029229 GTGTAGATTTTATTGGAGGGAGG - Intronic
923988469 1:239408300-239408322 GTCTCGATCTCCAAGGAGAGAGG - Intronic
1066040350 10:31543116-31543138 ATGTAGAGCTTCTTGGAGGGTGG - Intergenic
1066978975 10:42393566-42393588 TGGTAGATTTTTTAGGAGAGCGG - Intergenic
1068279852 10:54854556-54854578 GTGTTCAGCTCCTAGGAGAGTGG + Intronic
1068773661 10:60849339-60849361 GTGTTTATCTTCTAGGGGACAGG + Intergenic
1068796105 10:61082090-61082112 GAGTAGATCTTTTGGAAGAGAGG + Intergenic
1070545107 10:77446098-77446120 GTGTAGATCTCTTTGAAGAGAGG - Intronic
1073570266 10:104575460-104575482 GTGTAGACCTCCTACCAGAGTGG - Intergenic
1076436456 10:130447989-130448011 CTGAAAATCTTCTAAGAGAGTGG - Intergenic
1079497652 11:21063967-21063989 GTGTAGATCTTCTAGGAGAGTGG + Intronic
1082490888 11:53532196-53532218 GTGTACATGTTCTTGCAGAGTGG - Intergenic
1085718627 11:78894534-78894556 GTACAGATCTGTTAGGAGAGGGG + Intronic
1086198568 11:84171914-84171936 GTGAAGATAGTCTAGGAGAAGGG - Intronic
1088766144 11:112980954-112980976 CTGCCGGTCTTCTAGGAGAGAGG + Intronic
1089037889 11:115415035-115415057 ATATATATCTTCTAGCAGAGTGG + Intronic
1089451893 11:118604621-118604643 TTGTGGATCTTCTAGGACAAGGG - Intergenic
1090514585 11:127411889-127411911 GTGTTCAGCTTCTAGAAGAGAGG + Intergenic
1090617386 11:128527682-128527704 ATGCAGAGCTTCTAGGAGACTGG - Intronic
1095826135 12:46531644-46531666 GTGTTCATCTCCTAGAAGAGAGG - Intergenic
1097424088 12:59420047-59420069 GTGAAGATCTTCTAGCTGGGTGG + Intergenic
1097922652 12:65092942-65092964 GTCTAGCTCCTCCAGGAGAGGGG - Intronic
1100616550 12:96235595-96235617 GTGAGGATCTTCGAGGGGAGGGG + Intronic
1101364548 12:104059660-104059682 GAGCAGATCTTGAAGGAGAGTGG + Intronic
1102045101 12:109824797-109824819 GTGACCATCCTCTAGGAGAGGGG - Intronic
1104460301 12:128950510-128950532 GTCTAGATTTTCTTGCAGAGAGG - Intronic
1107034945 13:35892176-35892198 GTGCAGGTGTTCAAGGAGAGAGG - Intronic
1107121977 13:36805907-36805929 GAGGATTTCTTCTAGGAGAGTGG + Intergenic
1114266779 14:21076941-21076963 CTGAAGACATTCTAGGAGAGAGG + Intronic
1116201207 14:41799541-41799563 TTGTAGAACTTGTAGAAGAGGGG - Intronic
1117068758 14:52036792-52036814 CTGTATATCTTTTTGGAGAGAGG + Intronic
1126568022 15:50120192-50120214 GTGAGGATGTTCCAGGAGAGTGG - Intronic
1130417397 15:83706449-83706471 GTGTATTTCTTTTAGGAGAAAGG + Intronic
1130841673 15:87706618-87706640 GAGTACATCTTCTAGGTCAGTGG + Intergenic
1134434943 16:14247873-14247895 ACTTAGATCTTCTAGGAGAAGGG - Intronic
1135358540 16:21791229-21791251 TTGTGGAGTTTCTAGGAGAGTGG + Intergenic
1135457042 16:22607354-22607376 TTGTGGAGTTTCTAGGAGAGTGG + Intergenic
1149315537 17:55434956-55434978 AGGCAGATCTTCTAGAAGAGGGG + Intergenic
1149439003 17:56659487-56659509 GTGTGGTTATTCTAGGAAAGTGG - Intergenic
1150224371 17:63515476-63515498 GTGTTAATCCTCTAGGAGACAGG - Intronic
1155804360 18:30147328-30147350 GTGTGGATCTTTTGGGAAAGGGG + Intergenic
1157152153 18:45228893-45228915 GTATAGATGTTAAAGGAGAGGGG - Intronic
1160351987 18:78190516-78190538 GCCTAGATTTCCTAGGAGAGAGG - Intergenic
1164421175 19:28094223-28094245 GAGTAGATTTTCTAGGAAAAAGG - Intergenic
1165981929 19:39731770-39731792 TTGGAGATCTTCCAGGATAGAGG - Intronic
1166237857 19:41469488-41469510 GTGTACATCTTCTAAGATATTGG + Intergenic
1166357024 19:42233278-42233300 GTGGAGATCATCAAGGTGAGGGG - Exonic
1167521905 19:49960269-49960291 GTCTGGTTCTTCTAGGGGAGAGG + Exonic
1167523479 19:49970453-49970475 GTCTGGTTCTTCTAGGGGAGAGG - Intergenic
926625485 2:15086283-15086305 GTGTTCAGCTTCTAGCAGAGAGG - Intergenic
927434824 2:23058016-23058038 GTGGGGAGCTTCTGGGAGAGGGG + Intergenic
931715269 2:65023923-65023945 CTGTTGCTCTTCTAGGAGATGGG + Intergenic
935255752 2:101308404-101308426 GTGTGGAGCGTCTCGGAGAGTGG - Exonic
937564921 2:123273678-123273700 GTGTAGATCTTCTATTGGTGAGG + Intergenic
947533158 2:230925439-230925461 GTGCAGATCTTCCAAGAGGGCGG - Intronic
1169179051 20:3546155-3546177 CTGTTGAACTTCTAGAAGAGAGG + Intronic
1169622104 20:7518833-7518855 GTGTAGATATTTTATGAAAGTGG + Intergenic
1173191735 20:40882097-40882119 GGATAGATCTTCTTGGAAAGAGG + Intergenic
1173223775 20:41149824-41149846 GGGCAGAGCTTCAAGGAGAGAGG + Intronic
1179667287 21:42921617-42921639 GAGCAGATCATCAAGGAGAGTGG + Intergenic
1183035132 22:35135347-35135369 GTGAAGATCTTAGAGGAGAATGG + Intergenic
1184862408 22:47180572-47180594 GTGTGTAACTTCCAGGAGAGGGG + Intergenic
956119004 3:65947157-65947179 CTGTAGTTCTTCAAGGAAAGAGG + Intronic
956591062 3:70915108-70915130 GAGTTTTTCTTCTAGGAGAGAGG + Intergenic
957701329 3:83718087-83718109 GTATAGATCTTCTTTGACAGGGG - Intergenic
962105205 3:132382699-132382721 GTGTTCAGCTTCTAGGAAAGAGG + Intergenic
963068907 3:141286494-141286516 GGGTAGATTTTCTAGGAGGAAGG + Intronic
964255009 3:154766292-154766314 GTGTTCATCTCCTAGCAGAGAGG + Intergenic
964856458 3:161151026-161151048 GTGTTAATTTTCTGGGAGAGGGG + Intronic
966595742 3:181723515-181723537 AGGTAGACCTCCTAGGAGAGCGG + Intergenic
970011171 4:11460687-11460709 GTGTAGATCTTGTAGGCCACCGG - Intergenic
972911642 4:43823803-43823825 GTTTAGATCTCCTTGGAGACTGG - Intergenic
973104237 4:46313014-46313036 GTTTAGAGCTGCTTGGAGAGGGG + Intronic
974768356 4:66378358-66378380 GTGTAGAAATTCTAGGTGAGAGG - Intergenic
982300162 4:153870096-153870118 CTGTAGATTTTCTAGAACAGTGG - Intergenic
983730833 4:170991710-170991732 GTGTACATGTTCTTGCAGAGTGG + Intergenic
986905371 5:12488769-12488791 GTGTAGATTTTCTAGGGGAAGGG - Intergenic
989693670 5:44174084-44174106 GTGTCGATTTTCAAGGGGAGTGG - Intergenic
992904320 5:81331052-81331074 GCCCAGATCTTCTAGAAGAGTGG + Intronic
994245350 5:97470881-97470903 GTGTTGAGCTCCTAGCAGAGAGG + Intergenic
994390703 5:99189680-99189702 GTGTAGTTCTTTTGGGACAGGGG - Intergenic
994394685 5:99218058-99218080 GTGTACATCTTCTACGATATTGG + Intergenic
995737769 5:115320878-115320900 GTATGGATTTTCTAAGAGAGAGG + Intergenic
999125007 5:149240112-149240134 GTGGTGAACTTCCAGGAGAGGGG + Intronic
1004237973 6:13891748-13891770 GTCTTCACCTTCTAGGAGAGGGG + Intergenic
1004569048 6:16827305-16827327 GGGTAGACCTACTAGAAGAGTGG - Intergenic
1005399580 6:25417884-25417906 GTGAATATCTTTGAGGAGAGTGG - Intronic
1006776804 6:36599633-36599655 GTGGAGTCCTTCTAGGAGACAGG + Intronic
1007304062 6:40890777-40890799 ATGTAGCTCTTCTAGGAGTGGGG - Intergenic
1007778472 6:44237459-44237481 GTGTAGATGCTCTCGGGGAGAGG + Intergenic
1008271353 6:49494160-49494182 GTGTAGAACTTCTTAGAGATTGG + Intergenic
1008282841 6:49616749-49616771 GTGTGGATCTTCAAGGGGACTGG - Intronic
1010349191 6:74851379-74851401 CTCTAGCTCTTCTAGGAAAGTGG - Intergenic
1011038214 6:83000778-83000800 GTGAAGAGCTTCTAGGCAAGGGG - Intronic
1015663776 6:135604164-135604186 GTGTTCAGCTTCTAGCAGAGAGG - Intergenic
1015708556 6:136114605-136114627 GTGTAGTTCTTATAGGTGACAGG - Intronic
1016619317 6:146089634-146089656 GGATAGATTTTCTAGGAGTGTGG + Intronic
1017672783 6:156782342-156782364 GTGTATATATTATAGGAGAAGGG + Intronic
1019334620 7:477120-477142 CTGGAGGTCTTTTAGGAGAGCGG + Intergenic
1020271562 7:6599661-6599683 GTGTGGATGTTCTAGGAAAGGGG + Intronic
1023485428 7:40681413-40681435 GGGTAGAGGTTCCAGGAGAGTGG + Intronic
1023526695 7:41111318-41111340 GTGTATTTTTTCTTGGAGAGAGG + Intergenic
1029340216 7:99936583-99936605 GAGAAGATCTTTTTGGAGAGAGG - Intergenic
1033709334 7:143924769-143924791 GTGAAGATGTTAGAGGAGAGAGG + Intergenic
1036946002 8:13095521-13095543 TTCTAGATCTTCTAAGAGTGGGG + Intronic
1048656420 8:136542164-136542186 TTGTAGAGGATCTAGGAGAGTGG + Intergenic
1049653476 8:143787624-143787646 CTGTAGCTCTTCCAGGAGACTGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1058487495 9:105457159-105457181 GTGTATATGTTTTAGGACAGAGG + Intronic
1058518244 9:105796432-105796454 GTGTATATCTTCTTGGAAATTGG + Intergenic
1061304972 9:129726854-129726876 CTGGAGATCTCCCAGGAGAGCGG - Intergenic
1193321063 X:80122057-80122079 GGGTTAATCTTATAGGAGAGGGG - Intergenic
1195179023 X:102339097-102339119 GTGTTCATCTCCTAGCAGAGAGG + Intergenic
1197562173 X:128037092-128037114 GTATAGGTCATCCAGGAGAGGGG + Intergenic
1199038324 X:143079539-143079561 GTTTAGAACTTCTTAGAGAGTGG - Intergenic
1200933360 Y:8716834-8716856 GTGTACATACTCTAGGTGAGTGG + Intergenic