ID: 1079502593

View in Genome Browser
Species Human (GRCh38)
Location 11:21118329-21118351
Sequence GGTCCTTGAATCTGGCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079502593_1079502596 14 Left 1079502593 11:21118329-21118351 CCTCTAGGCCAGATTCAAGGACC 0: 1
1: 0
2: 1
3: 13
4: 88
Right 1079502596 11:21118366-21118388 TCATAGTAAGCTTGAGTCTTTGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079502593 Original CRISPR GGTCCTTGAATCTGGCCTAG AGG (reversed) Intronic