ID: 1079503759

View in Genome Browser
Species Human (GRCh38)
Location 11:21131957-21131979
Sequence CTGGAGACACAGGTACAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 381}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079503753_1079503759 9 Left 1079503753 11:21131925-21131947 CCTTTGCACATCAGGAGATTTCT 0: 1
1: 0
2: 1
3: 14
4: 149
Right 1079503759 11:21131957-21131979 CTGGAGACACAGGTACAGGATGG 0: 1
1: 0
2: 4
3: 29
4: 381
1079503752_1079503759 13 Left 1079503752 11:21131921-21131943 CCTTCCTTTGCACATCAGGAGAT 0: 1
1: 0
2: 0
3: 19
4: 187
Right 1079503759 11:21131957-21131979 CTGGAGACACAGGTACAGGATGG 0: 1
1: 0
2: 4
3: 29
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079503759 Original CRISPR CTGGAGACACAGGTACAGGA TGG Intronic
900615585 1:3564335-3564357 CTGGACAAACAGCTACTGGAGGG + Intronic
900680125 1:3911992-3912014 CTGGAGACAAAGGAAGAGAAAGG - Intergenic
900967259 1:5967312-5967334 CTGGAGAAGCGGGTGCAGGAGGG + Exonic
901646008 1:10717072-10717094 CTGGAGGGACAGGAGCAGGAGGG + Intronic
903503533 1:23816021-23816043 CGGGAGACTGAGGCACAGGATGG - Intronic
904710122 1:32423960-32423982 CTGGACAAACAGTTACTGGAGGG + Intergenic
904805489 1:33128582-33128604 CTGTAGACACAGGAAGAGGGTGG - Intergenic
905203567 1:36329981-36330003 CTGGACAAACAGTTACTGGAAGG - Intergenic
905263326 1:36734278-36734300 CTGGAGAGACCGGGACAGGAGGG - Intergenic
906348429 1:45036249-45036271 CTGCAGCCACAGGTACATGCTGG + Exonic
906673918 1:47679500-47679522 TTGGAGACACAGGAAGAGGCAGG - Intergenic
906674082 1:47680756-47680778 CTGAAGACACAGGGAGAAGACGG - Intergenic
907044085 1:51289098-51289120 CTGGAGCCCAAGGTACAGGATGG - Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
907951168 1:59185552-59185574 AGGCAGACTCAGGTACAGGAGGG - Intergenic
908466431 1:64400875-64400897 CTGGAGACTAATGTACAGCATGG - Intergenic
913237356 1:116796493-116796515 CTGGAGACACAGGGACATGGAGG - Intergenic
914897808 1:151692483-151692505 CTGGAGTCACAGGCACAGTGGGG - Exonic
915496175 1:156284283-156284305 TTTGAGACACAGGTAAAGGGAGG + Exonic
915933429 1:160075141-160075163 CTGGAGAGAAAGGTGAAGGATGG - Intergenic
916191033 1:162178541-162178563 GAGGAGACTCAGGCACAGGAGGG + Intronic
918239005 1:182605417-182605439 CTGAAGACCCAGCTGCAGGAAGG + Intergenic
920164598 1:204026600-204026622 CTGGAGACAAAGGCAGAGGGAGG + Intergenic
920766311 1:208836978-208837000 CTGGAAACAGTGGGACAGGAGGG + Intergenic
921874427 1:220177927-220177949 CAGAATATACAGGTACAGGAAGG + Intronic
921968576 1:221119898-221119920 CTGAAGACACAGGGAGAAGATGG + Intergenic
922709353 1:227815657-227815679 CTGGAGACACAGTCACATGTCGG + Intergenic
923051276 1:230392941-230392963 CTGGAGGGAGAGGCACAGGAAGG + Intronic
924321560 1:242855667-242855689 CTGGAGAAACAGGGACAAGTCGG - Intergenic
1063745694 10:8878020-8878042 CTAGAGAGACTGGTGCAGGATGG + Intergenic
1064056005 10:12097979-12098001 CTGAAGACACATGTTCAGGTGGG + Exonic
1066162552 10:32749118-32749140 CTGGAGAAACAGGTAAAGATAGG - Intronic
1067062079 10:43082722-43082744 CTGGAGTCACAGGCACACAAGGG - Intronic
1067902081 10:50252716-50252738 CTGCAGACCCAGGATCAGGATGG + Intergenic
1067977425 10:51041979-51042001 ATGGAGACTCAGGTTCAGGCAGG - Intronic
1068812786 10:61275408-61275430 CTGGAGACACAGGTAATCTAGGG + Intergenic
1068990019 10:63140534-63140556 CTGTAGTCCCAGCTACAGGAGGG - Intronic
1069682706 10:70296636-70296658 CTGGAGACACAGTCAGAGCACGG + Intergenic
1070329501 10:75407600-75407622 CTCCAGACACAGGCGCAGGAGGG - Intergenic
1071186256 10:83049690-83049712 CTGGAGATATAGTTACAGGAAGG - Intergenic
1071265101 10:83957883-83957905 ATGGAGACACATGTCCAAGAGGG - Intergenic
1071844079 10:89503798-89503820 CTGGGGCCACAGCAACAGGAAGG + Intronic
1074493071 10:113956054-113956076 CTGGAGACAGAGGCAGAGAATGG - Intergenic
1074532324 10:114305906-114305928 GAGGGGACACAGGTGCAGGAGGG + Intronic
1075558923 10:123454254-123454276 CTGGTGATACAGGAACAAGAGGG - Intergenic
1076034392 10:127186863-127186885 ATGCACACACAGATACAGGAGGG + Intronic
1076087535 10:127648459-127648481 CTGGAGACACGAGCACAGGATGG + Intergenic
1076201748 10:128564427-128564449 GTGAAGACACAGGGACAAGATGG + Intergenic
1076647051 10:131960881-131960903 CTGCAGGCAAAGGGACAGGATGG + Intergenic
1076736777 10:132462528-132462550 CTGGAGACCCAGGTAAAACAAGG - Intergenic
1076994909 11:293140-293162 CTGGACACACAAGTCCAAGATGG - Intronic
1077444775 11:2585836-2585858 CTGGAGCAACAGGGGCAGGAAGG + Intronic
1077477826 11:2798897-2798919 CTGGAGGAGCAGGAACAGGACGG + Intronic
1077555978 11:3226293-3226315 CTGGAGAAACAAGAACAGAAAGG - Intergenic
1077865968 11:6222338-6222360 CTGGAGATACAGGCAAAAGAAGG + Intronic
1078901850 11:15649938-15649960 CTGGGGACACAGGGGCACGAGGG - Intergenic
1079503759 11:21131957-21131979 CTGGAGACACAGGTACAGGATGG + Intronic
1080489486 11:32747748-32747770 CTGCCGAGACAGGCACAGGAGGG + Intronic
1081222839 11:40483236-40483258 CTGGAGACAAAGCTAGAGGGAGG + Intronic
1083800141 11:65041752-65041774 CTGCAGGCCCAGGTGCAGGAGGG + Exonic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084564385 11:69920935-69920957 CAGCAGCCACAGGTGCAGGAGGG + Intergenic
1084938859 11:72601663-72601685 CAGGAGACACAAGAAGAGGAAGG + Intronic
1084941073 11:72613652-72613674 CTGGAGACACAGGAGTAGGTGGG - Intronic
1086412917 11:86559867-86559889 CAGGAGACAAAGGAACAGAAGGG + Intronic
1087332089 11:96793346-96793368 CTGCCGAGCCAGGTACAGGAGGG + Intergenic
1089102325 11:115973952-115973974 CTGGAGTCACAGAAACTGGATGG - Intergenic
1089607934 11:119652380-119652402 CTGGAGAGGCTGGGACAGGATGG - Intronic
1091006785 11:131960870-131960892 CTGAAGATTCAGGTGCAGGAGGG + Intronic
1091820230 12:3470613-3470635 CTGGAGACCCTGTTCCAGGAAGG - Intronic
1092946489 12:13458733-13458755 CTGGAAACCCAGGTCCAAGATGG - Intergenic
1093971413 12:25379495-25379517 CTGGAGACAAAGAGACAAGATGG - Intergenic
1094320632 12:29179010-29179032 CTGAAGACACAGGAAAAAGATGG - Intronic
1095341326 12:41092480-41092502 CAGAAGACACAGGTAAATGAAGG - Intergenic
1096004906 12:48161637-48161659 CTGGACACCCAGATTCAGGAGGG + Intronic
1096035105 12:48460007-48460029 CTGGTCAAACTGGTACAGGATGG + Intergenic
1097478648 12:60092122-60092144 CTGGACAAACAGTTACTGGAGGG + Intergenic
1098039172 12:66336759-66336781 CTGCAGACACAGGAACTGGCAGG + Intronic
1098132836 12:67368360-67368382 CTGGAAACACAGAGAAAGGATGG + Intergenic
1101071491 12:101080591-101080613 CTGAAGACACAGGGAGAAGATGG - Intronic
1101214464 12:102566764-102566786 GTGAAGACACAGGAAGAGGATGG - Intergenic
1101337188 12:103807214-103807236 CTAGGGACACAGGTAGGGGAGGG - Intronic
1101341124 12:103842002-103842024 GTGGAACCACAGGCACAGGACGG - Intronic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1102195717 12:111023877-111023899 CTGAAGAAACAGGTTCAGGCAGG + Intergenic
1102373699 12:112403868-112403890 CTGGAACCACAGGTACACGCAGG + Intergenic
1103040105 12:117687914-117687936 CTGGAGACCCAGGCTCAGAAAGG - Intronic
1103846964 12:123908399-123908421 CAGGAGACAGAGGTCCCGGAGGG - Intronic
1104429171 12:128702880-128702902 ATGGGGACAAAGGTCCAGGAAGG + Intronic
1104517163 12:129438301-129438323 CTGAAGACACATGTGCAGAAAGG + Intronic
1104801543 12:131558249-131558271 CTGGGGACAGAGGAACAGAAAGG + Intergenic
1112086628 13:96038992-96039014 ATGGAGAGACAGGCATAGGATGG + Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113077120 13:106477948-106477970 GTGAAGACACAGGGAGAGGACGG - Intergenic
1113228100 13:108180829-108180851 CTGGAGACCCAGGTATCGGCTGG - Intergenic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1113821969 13:113221094-113221116 CTGGTGCCACAGCCACAGGAGGG - Intronic
1113822607 13:113225722-113225744 CTGGAGTCAGAGCTGCAGGATGG + Intronic
1114206827 14:20579649-20579671 GTGGGGGCATAGGTACAGGAAGG - Intergenic
1115149705 14:30270419-30270441 CTTAAGATACAGGCACAGGAAGG + Intergenic
1116912759 14:50488651-50488673 CTGGAAACACAGTTGCAGGGTGG - Intronic
1116967428 14:51029224-51029246 CTGAAGTTACAGGCACAGGATGG + Intronic
1117528156 14:56632260-56632282 ATGCAGACACAGTCACAGGAAGG - Intronic
1118793949 14:69122625-69122647 CTGGAAAGACAGGAACAGGGTGG - Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119531141 14:75362184-75362206 CTGGAGACACACTCTCAGGAAGG - Intergenic
1120938132 14:89918810-89918832 GGGCAGCCACAGGTACAGGAGGG + Intronic
1121314395 14:92952459-92952481 CTAGAGACATAGGGACAGGCTGG + Intronic
1121745255 14:96284200-96284222 CTGGCGACACACTAACAGGAAGG - Exonic
1122166349 14:99827253-99827275 CTGAAGACACAGGGAGAAGATGG + Intronic
1122574153 14:102731338-102731360 GTGGAGCCACAGCTACAGGCAGG + Intergenic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1123585132 15:21753205-21753227 CTGGAGACACTGTCTCAGGAGGG - Intergenic
1123621779 15:22195812-22195834 CTGGAGACACTGTCTCAGGAGGG - Intergenic
1124666655 15:31598522-31598544 CTGGTGACATAGGCACTGGAAGG - Intronic
1125636776 15:41195764-41195786 TTTGACACACAGGTACATGAAGG - Exonic
1125832840 15:42728733-42728755 CTGGTGACACAGGGAGAGGAAGG - Exonic
1126293208 15:47105993-47106015 CTGGAGACATAAATAGAGGAAGG - Intergenic
1127263239 15:57341143-57341165 CTGGAGGTGCAGGGACAGGAAGG + Intergenic
1127992748 15:64132928-64132950 CTGGAGAGCCAGCTGCAGGAAGG + Intronic
1128690572 15:69721696-69721718 CTGAAGACTCCGGTACAGGCCGG + Intergenic
1129505962 15:76081648-76081670 ATGGACACTCAGGTTCAGGAAGG - Intronic
1130567476 15:85008864-85008886 CTCGAGACACAGGGAGAGGGAGG - Intronic
1130983111 15:88826476-88826498 CTGGAGACACAGGGAAAGCCAGG + Intronic
1132249624 15:100325446-100325468 GTGAAGACACAGGGAGAGGACGG + Intronic
1132342455 15:101087044-101087066 CTGGAGACAGAGGAGAAGGAGGG + Intergenic
1133088268 16:3382664-3382686 CTGGAGTCACAGGCACAGCCAGG + Exonic
1133922090 16:10162547-10162569 GTGAAGACACAGGGAGAGGATGG - Intronic
1134182463 16:12058913-12058935 CTGTAGACCCAGCTACTGGAGGG - Intronic
1134247634 16:12551841-12551863 CTGGGGACACAGGAGCAGGCAGG + Intronic
1135222220 16:20623061-20623083 CAGGACACAGGGGTACAGGAGGG - Intronic
1139236314 16:65343300-65343322 CTGGGGACAGGGGAACAGGATGG + Intergenic
1140879434 16:79184603-79184625 CAGGAGAGGCAGGTACAGGCTGG - Intronic
1141026564 16:80554323-80554345 CTGGATGCAAAGGTACAGGCAGG - Intergenic
1141461595 16:84181317-84181339 CTGGACACTCAGGTACGGGCTGG - Exonic
1142034456 16:87854890-87854912 GTGGAGACACAGGTGAAGGGAGG - Intronic
1144627112 17:16849627-16849649 CTGGGGTGACAGGTACAGGGTGG + Intergenic
1144879329 17:18423085-18423107 CTGGGGTGACAGGTACAGGGTGG - Intergenic
1145152911 17:20521302-20521324 CTGGGGTGACAGGTACAGGGTGG + Intergenic
1147195158 17:38761608-38761630 CTGGGGGCAAAGGTACAGGAAGG + Intronic
1147581253 17:41628312-41628334 CTGGGGTGACAGGTACAGGGTGG + Intergenic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1149249671 17:54753971-54753993 CAGGAGAAATAGGTCCAGGAGGG + Intergenic
1149455191 17:56782020-56782042 GTGAAGACCCACGTACAGGAAGG - Intergenic
1149462905 17:56847683-56847705 CTGGAAACTGAGGTGCAGGAAGG - Intronic
1149622629 17:58057495-58057517 CTGTAGGCTCAGGAACAGGAAGG + Intergenic
1150345996 17:64405175-64405197 CTGAAGACAAAGGAAAAGGAAGG + Intronic
1150815303 17:68388017-68388039 CCACAGACACAAGTACAGGATGG + Intronic
1151153545 17:72108503-72108525 CTGAAGGAACATGTACAGGAAGG - Intergenic
1151775323 17:76197261-76197283 CAGGAGAAACAGTTACAGTAAGG + Intronic
1152804149 17:82347180-82347202 CTGGAGACAGAGAGACAGAAGGG + Intergenic
1153304901 18:3622560-3622582 CTGTGGACACAGGCACAGGCTGG - Intronic
1154145213 18:11861284-11861306 CTGGAGACAGAGGGGCAGCAGGG - Intronic
1154324533 18:13380340-13380362 CAGGAGACACTGGCTCAGGAGGG - Intronic
1155010266 18:21770249-21770271 TTGGAGTCACATGTACAAGATGG - Intronic
1155092857 18:22528145-22528167 GTGGAGACAGAGGAAGAGGATGG - Intergenic
1157922646 18:51729204-51729226 CAAGAGACAAAGGTACAGAATGG - Intergenic
1158703696 18:59771678-59771700 CTGCAGAGCCAGGCACAGGAGGG - Intergenic
1159820267 18:73132232-73132254 CTGAAGACACAGGGAGAAGATGG + Intergenic
1161137063 19:2626183-2626205 CTGGAGACACGGGGTCAGGTGGG - Intronic
1161243157 19:3234158-3234180 ATGGAGGCCCAGGTAGAGGAGGG + Intronic
1161253281 19:3292948-3292970 CTGGAGACACAGATCCTGGCTGG + Intronic
1161356199 19:3820743-3820765 CAGGAGACACAGGAACACCAGGG + Intronic
1161812815 19:6480233-6480255 TTGAACACACAAGTACAGGATGG + Intronic
1163031147 19:14545091-14545113 CTGGGGACAGAGGAACAGTAAGG - Intronic
1163691558 19:18741399-18741421 TCGGGGACACAGGTCCAGGAGGG + Intronic
1164131556 19:22367446-22367468 CTGGGCACACAGCTAGAGGAAGG + Intergenic
1164393800 19:27846798-27846820 CTGGACAAACAGATACTGGAGGG + Intergenic
1164823478 19:31267468-31267490 CTGGGGACACGGGTAGGGGAAGG - Intergenic
1166423709 19:42657356-42657378 CTGGGGACACTGGTTCATGATGG - Intronic
1167765273 19:51478559-51478581 CAGGAGACACAGGTCTTGGAGGG + Intergenic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
1168697050 19:58409378-58409400 CTGGAGACGCATGTGCAGAACGG + Intronic
925034172 2:673351-673373 CTGGAGGCAAAGGCACGGGAGGG + Intronic
925134374 2:1516140-1516162 ATGAAGACACAGGTCCAGGTGGG + Intronic
925146813 2:1587704-1587726 GTGGGGACAGAGGGACAGGATGG - Intergenic
925146874 2:1587913-1587935 GTGGGGACAGAGGGACAGGATGG - Intergenic
925192770 2:1898848-1898870 CTGGAGACAGAGGGCCAGGGAGG + Intronic
925205673 2:2003635-2003657 CTGAAGACTCAGGTACAGGAAGG - Intronic
925881915 2:8359871-8359893 CTGGAGAATCAGGCACAGGATGG + Intergenic
926816290 2:16801003-16801025 CTGGAGACACAGAAACACAAAGG + Intergenic
926889438 2:17626565-17626587 CTGCAGACACAGGGGCAGGGTGG - Intronic
927502491 2:23591893-23591915 CTGGAGATAAAGGAAGAGGAAGG - Intronic
927952040 2:27177572-27177594 CTGTAGTCCCAGGTACAGGAGGG - Intergenic
927954547 2:27199438-27199460 CTGCAGACACAGGGACAGCAGGG + Intergenic
928100858 2:28436743-28436765 CTGGAATCACAGGAGCAGGAAGG + Intergenic
930192826 2:48478020-48478042 CTGGAGACAGAGATACAAGGGGG + Intronic
930524527 2:52511060-52511082 ATGGAGACTCAGTAACAGGATGG + Intergenic
932442700 2:71747826-71747848 CTGGAGACTGAGGTACAGAAAGG - Intergenic
932599030 2:73111750-73111772 CAGGACACAGAGGGACAGGATGG + Intronic
932663013 2:73673272-73673294 CTGGAGACAAGGGCACAGGAGGG + Intergenic
932673465 2:73757843-73757865 TTGTAGACACATTTACAGGATGG + Intergenic
932766710 2:74475116-74475138 CTGAAGGCAGAGGTACAGTATGG + Intronic
935040077 2:99417584-99417606 GTGAAGACACAGGGAGAGGAGGG + Intronic
936072787 2:109382518-109382540 CTGGGGACACAGCTGCAAGACGG - Intronic
937085185 2:119166953-119166975 CTGAAGACACAGGTACGGCAGGG + Intergenic
937135699 2:119550166-119550188 CTGGAGACAGGGCCACAGGAGGG - Intronic
937219013 2:120330809-120330831 GTGAAGACACAGGGAGAGGACGG + Intergenic
937310576 2:120900331-120900353 CTGAATCCACAGGTCCAGGATGG + Intronic
938176417 2:129135274-129135296 CTGGACAGAGAGGTATAGGAAGG + Intergenic
938444640 2:131367346-131367368 CTGGAGACAGAGGCACCTGAGGG + Intergenic
939512651 2:143125800-143125822 CTGTTGACACAGTAACAGGAAGG - Intronic
939798575 2:146678924-146678946 CTGGAGACAGACGTACTGCAGGG - Intergenic
942486686 2:176447015-176447037 TTGAAGCCACAGGTGCAGGAGGG + Intergenic
942629340 2:177938939-177938961 GTGAAGACACAGGAACAAGATGG + Intronic
942672272 2:178388738-178388760 CTGGAGACAGAAGTATGGGAGGG - Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943259751 2:185643926-185643948 CTGGAGACAAGAGTAGAGGATGG + Intergenic
944893966 2:204145307-204145329 TTGGAGACACTGGGTCAGGAAGG - Intergenic
945021785 2:205580433-205580455 GTGGTGACACTGTTACAGGAGGG + Intronic
946373461 2:219294595-219294617 CTGGAGACAGCGGGGCAGGAGGG + Intronic
947364629 2:229381292-229381314 CTGGTGACATAGGTACCCGAGGG - Intronic
947561489 2:231157687-231157709 CTGTAGTCCCAGCTACAGGAGGG - Intronic
947669862 2:231929305-231929327 CTGGAAACACAGGAAGAGAAGGG + Intergenic
948029408 2:234804797-234804819 CAGGAAACAGAGGTGCAGGAGGG + Intergenic
948258372 2:236584679-236584701 CTGGAGCCCCAGGCACAGGGTGG + Intergenic
948827189 2:240578421-240578443 CAGGGGACACAGGGAGAGGATGG + Exonic
1168996718 20:2138648-2138670 CTGGGGAGGCAGGTCCAGGAGGG + Intronic
1170403762 20:16014657-16014679 CTGGGGAGCCAGGGACAGGAAGG - Intronic
1170878313 20:20271792-20271814 CAGGTGACAGAGGTAAAGGATGG - Intronic
1171339655 20:24417474-24417496 CTGAAGACACAGGTGCGGGCGGG + Intergenic
1171359611 20:24577796-24577818 CTGGAGGCACATGTAAATGATGG + Intronic
1171536162 20:25892577-25892599 CTGGAGACAGAAATAGAGGAAGG + Intergenic
1171804936 20:29668581-29668603 CTGGAGACATAAATAGAGGAAGG - Intergenic
1171839123 20:30187847-30187869 CTGGAGACATAAATAGAGGAAGG + Intergenic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172151767 20:32795881-32795903 CTTAAGAGAAAGGTACAGGAAGG + Intronic
1172390163 20:34560336-34560358 CTGGAGGCACAGGGCCAGGCAGG - Exonic
1172861122 20:38053005-38053027 CTGGAGACACAGGGACAAGTTGG + Intronic
1173162194 20:40661301-40661323 CTGCAGAGACAGGAACAGGCAGG + Intergenic
1173163477 20:40669878-40669900 CTGTGGACACAGGCCCAGGAGGG + Intergenic
1174061279 20:47834711-47834733 CTGGAGACCCAGGGAGAAGATGG - Intergenic
1174070248 20:47894612-47894634 CTGGAGACCCAGGGAGAAGATGG + Intergenic
1174101074 20:48126596-48126618 CTGGAGACGCAGGGAGAAGATGG - Intergenic
1174156146 20:48516614-48516636 CTGGAGACCCAGGGAGAAGATGG - Intergenic
1174709840 20:52692827-52692849 CTGGAGCCATGGGTACAGGAAGG - Intergenic
1174812914 20:53662693-53662715 CTGAAGAGACAGGTACTGGCTGG - Intergenic
1175168096 20:57060702-57060724 CTGGGGACAGAGCTACACGAGGG + Intergenic
1175369512 20:58478449-58478471 GTGGAGTCACAGGCAGAGGAAGG - Intronic
1175705121 20:61171084-61171106 CTGGAGTTACAGCTAGAGGAAGG - Intergenic
1176079407 20:63264506-63264528 CTGGAGACACAGGGACAGCTAGG - Intronic
1179361631 21:40714584-40714606 ATGGTGAGACAGGAACAGGATGG - Intronic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1181041929 22:20196410-20196432 CTGGAGACGCAGGTGCAGGTGGG - Intergenic
1181189768 22:21129679-21129701 CTGGCGGCATAGGTACTGGAAGG + Intergenic
1181209436 22:21280830-21280852 CTGGCGGCATAGGTACTGGAAGG - Intergenic
1181708035 22:24660806-24660828 CTGGCGGCATAGGTACTGGAAGG + Intergenic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182820766 22:33214254-33214276 CTGAAGACACAGGGAGAAGATGG - Intronic
1182900180 22:33891479-33891501 TAGGAGAGACAGGTGCAGGAAGG + Intronic
1183163500 22:36130620-36130642 CTGGCGACCCAGGTATAGAAGGG - Intergenic
1183535471 22:38398427-38398449 CCGGAGCCACAGGTAAAGGGGGG - Intronic
1184304837 22:43590698-43590720 CAGAAGACAGAGGTACAGCACGG + Intronic
1184692625 22:46124101-46124123 CTGGAGCCAGAGGGACTGGATGG + Intergenic
1184896218 22:47408444-47408466 CTGGAGGGACAGTGACAGGAGGG + Intergenic
1203217511 22_KI270731v1_random:14615-14637 CTGGCGGCATAGGTACTGGAAGG + Intergenic
950456768 3:13097369-13097391 CTGGAGACTCAGTGACTGGAGGG - Intergenic
950685983 3:14618979-14619001 ATGGGGACCCACGTACAGGATGG - Intergenic
952245468 3:31585607-31585629 CTGACTACAAAGGTACAGGAGGG - Intronic
952330786 3:32362805-32362827 CTGGAGACAGAGCAACAGGAAGG - Intronic
953741799 3:45544938-45544960 CTGGAGACAAAGCTAAAGGTAGG + Intronic
953827907 3:46270207-46270229 CTGGATGCATAGGTAGAGGAGGG - Intergenic
954458838 3:50614590-50614612 TTGGACACACAGCTACATGAAGG + Intronic
955921633 3:63963036-63963058 CTGTAGTCCCAGGTACTGGAAGG - Intronic
956621993 3:71230461-71230483 CTGGAAACAAAGGAACAGGAGGG + Intronic
957021046 3:75126469-75126491 CAGGAAACACAGGTAGAGAATGG + Intergenic
957021375 3:75131794-75131816 CTGGAGACCTAAGTACAGCATGG + Intergenic
958937422 3:100272013-100272035 ATGGAGACAAAGGTAAGGGATGG - Intronic
958958813 3:100489879-100489901 CTGTAGTCTCAGGTACAGGTGGG - Intergenic
959571507 3:107889314-107889336 CTTGGGAGACAGGTACAGGTGGG + Intergenic
959859360 3:111199349-111199371 CTGTAAACACAGCTACAGAATGG - Intronic
960789446 3:121412131-121412153 CTGGAGTCACAGGCACAGCCAGG - Intronic
962321726 3:134396161-134396183 CAGGAGACAAAGAGACAGGAAGG - Intergenic
962420323 3:135222753-135222775 TTGGAGACATAGGTCCAGGAGGG - Intronic
962803708 3:138911947-138911969 CTGGAGAAACAGGCACATTAAGG - Intergenic
962847996 3:139287839-139287861 CTGGACAGACAGGTAAACGATGG + Intronic
963123478 3:141795081-141795103 CTGGAGTCACAGGGTCAGGAAGG + Intronic
963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG + Intronic
964426904 3:156563129-156563151 CTTGAGACAGAGGCAGAGGAAGG - Intergenic
964502895 3:157368230-157368252 CTGGAGACACAGGCACGGAAAGG - Intronic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
964961718 3:162436190-162436212 TTGGAGAAACAGGGCCAGGAAGG + Intergenic
966760458 3:183413508-183413530 CTGGACAAACAGTTACTGGAGGG - Intronic
967292225 3:187932410-187932432 TTGGTGACACAGGTAAAGCAGGG + Intergenic
967923779 3:194631306-194631328 CTGGAGACACCGAGACAGGGTGG + Intronic
968058564 3:195711515-195711537 CTGGGAACACAGGCACAGGTGGG + Intergenic
968183225 3:196612627-196612649 CTGGAGACTCAGGTATGGAAAGG - Intergenic
969176400 4:5402307-5402329 ATGGAGCCACAGGCACAGGCCGG + Intronic
969265247 4:6060236-6060258 CTCGGCACACAGGTACAGTAGGG + Intronic
970974131 4:22023413-22023435 CTGGGGACACAGGTTGAGGCTGG + Intergenic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
974533393 4:63142730-63142752 CTTGAGATACAGGTAAGGGAAGG - Intergenic
976072218 4:81254453-81254475 CTGGGTACACAGGGACAGGAAGG - Intergenic
976089026 4:81435899-81435921 CTGTAGTCCCAGGTATAGGAGGG - Intronic
977589927 4:98814747-98814769 TTGGAGGAACAGGTCCAGGAAGG - Intergenic
978313231 4:107409309-107409331 CTGGAGGCATAGGCACTGGAGGG - Intergenic
978577853 4:110203708-110203730 CTGGTCAGACAGTTACAGGAAGG + Intergenic
979568948 4:122193068-122193090 CTGGACACAGAGGTACACAAGGG - Intronic
980159155 4:129138585-129138607 CTGCAGCCACAGGTACATGTTGG + Intergenic
983197590 4:164824506-164824528 CTGAAGACACAGGAACACCAAGG - Intergenic
984049310 4:174843972-174843994 CTGGAGACCTGGGAACAGGAAGG + Intronic
985921940 5:2984318-2984340 TGGGAGACCCAGGTCCAGGAGGG - Intergenic
986372226 5:7091630-7091652 ATGGTGACACAGATACAGTATGG + Intergenic
988434107 5:31153537-31153559 CTGGAGAGCCAGGTTCAGGGAGG - Intergenic
988503034 5:31799286-31799308 CTGCAGCCACTGGTAGAGGAGGG - Exonic
988785112 5:34559679-34559701 CTGAAGACACAGGCAAAAGATGG - Intergenic
990018843 5:51100821-51100843 CTGGACAAACAGTTACTGGAGGG - Intergenic
990688976 5:58340801-58340823 CAGGAGATGCAGGTACAGGGAGG + Intergenic
990868321 5:60403754-60403776 CTGGAGAGACAGCATCAGGAAGG - Intronic
991942513 5:71866136-71866158 CTAGAGACACAGGTCTAGGGAGG + Intergenic
991986203 5:72289188-72289210 CTTGAGACCCACGTACAGCATGG + Intronic
995687956 5:114791683-114791705 CAGGAGATCCAGGTAGAGGATGG + Intergenic
995808988 5:116084382-116084404 CTGCAGATGCAGATACAGGAGGG + Intergenic
997530268 5:134577512-134577534 CTTGAGACAGAGGGACAGAAAGG - Intronic
999196536 5:149785177-149785199 CTGGAGACTGAGGCCCAGGAGGG - Intronic
999246452 5:150157554-150157576 CAGGTGACACAGGTAGAGGCTGG + Intergenic
1001445837 5:171782217-171782239 CTGGACACAGAAGGACAGGAGGG + Intergenic
1001689348 5:173621323-173621345 GTGAAGACAGAGGTAGAGGATGG - Intergenic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1002419087 5:179136199-179136221 TAGGAGACACAGAGACAGGAAGG - Intronic
1002447143 5:179296535-179296557 CGGGAGACAGTGGTACAGGCAGG + Intronic
1002650914 5:180692982-180693004 CTGAAGACACATGAACATGATGG + Intergenic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1003505775 6:6739189-6739211 CTGGGGTCACAGGCACTGGAAGG - Intergenic
1004415276 6:15417619-15417641 CTGTAGTCCCAGTTACAGGAGGG + Intronic
1005843271 6:29758483-29758505 CTGCAAACAGATGTACAGGAGGG + Intergenic
1006254040 6:32815071-32815093 CTGTAGACACAACTACAGGCTGG - Exonic
1009345804 6:62611928-62611950 CTGGAGACAGGGATACAGGCTGG - Intergenic
1012629703 6:101449670-101449692 CTGGAGACACAGAGACACAAAGG - Intronic
1013548492 6:111183801-111183823 CTGAAGACACAGTTACTTGAGGG - Intronic
1016581063 6:145629740-145629762 CTGGAGAGACAGGCACAGCAGGG - Intronic
1016605601 6:145920589-145920611 CAGGTGACATAGGTAGAGGAAGG - Intronic
1018739213 6:166714608-166714630 CTGGAGACAGAGGCAGAGGCGGG + Intronic
1020475583 7:8590196-8590218 CTAGAGAGACAGATACTGGAGGG + Intronic
1021088680 7:16454686-16454708 GTGGAGACCCAGCTTCAGGAGGG - Intergenic
1022615012 7:31920354-31920376 CTGGAGAGACAGGAGCAGAATGG - Intronic
1024367437 7:48537026-48537048 ATACAGACACAGGTATAGGAAGG - Intronic
1024483928 7:49894729-49894751 CTGGAGACACAGGAGCAGCCAGG + Intronic
1025233143 7:57216357-57216379 CTGGAGACCCAGGGAGAAGATGG + Intergenic
1025287636 7:57679285-57679307 CTGGAGACATAAATAGAGGAAGG + Intergenic
1026808846 7:73445199-73445221 CTGGACACAGAGGTCTAGGAAGG + Intronic
1028154828 7:87418127-87418149 CTGGAGACAGTGGTTCAGGGTGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1029482002 7:100819056-100819078 CTGGAGAGTTAAGTACAGGAAGG - Intronic
1031895814 7:127347216-127347238 CTGGAGATGAAGTTACAGGAAGG + Intronic
1033459092 7:141529222-141529244 ATGGAGACACAGACACACGAGGG - Intergenic
1033570905 7:142627393-142627415 CTAGAGACACAGCGCCAGGAGGG + Intergenic
1035206728 7:157298506-157298528 ATTGAGACACAGGGACAGGGAGG + Intergenic
1035526244 8:315507-315529 GTGAAGACACAGGGAGAGGATGG - Intergenic
1035705499 8:1671499-1671521 ATGGAGAGACAGCTCCAGGAGGG + Intronic
1035727599 8:1834409-1834431 CTGGAGACACAGGCCCAGGGAGG + Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1038146767 8:24904558-24904580 GTGAAGACACAGGGAGAGGACGG + Intergenic
1040521549 8:48180593-48180615 CTGCAGGCTCAGGTAGAGGAAGG - Intergenic
1040765284 8:50902398-50902420 CTGGGGATACAGGTGCAGTATGG - Intergenic
1040905436 8:52465132-52465154 CTGGAGAGACAGGGATAGGCTGG + Intergenic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041884905 8:62797496-62797518 CAGGAGACACAGGTAAACAATGG - Intronic
1043485953 8:80699769-80699791 CGGGAGAAAGAGGGACAGGAGGG - Intronic
1044490555 8:92809242-92809264 CTGAAGGCACAGGCACAGGATGG + Intergenic
1045327354 8:101126902-101126924 GGGGAGACACAGTGACAGGACGG - Intergenic
1045393648 8:101739162-101739184 TTGGAGCCACAGGGACACGAGGG - Intronic
1045429046 8:102096278-102096300 GTGAAGACACAGGGAGAGGAAGG - Intronic
1045600207 8:103706804-103706826 ATGGATATACAGGTACAAGAAGG - Intronic
1045791103 8:105985655-105985677 CTGTAGTCCCAGCTACAGGAGGG - Intergenic
1046976006 8:120278471-120278493 CTGCAGAGTCAGGTACAAGAAGG + Exonic
1047193544 8:122700495-122700517 CTGAAGACACAGGGAGAGGATGG + Intergenic
1047204297 8:122791049-122791071 CTGGAGCCACAGGTGCATGGAGG - Intronic
1047220831 8:122917008-122917030 CTGGGGACAGAGGTGCTGGAGGG - Intronic
1047343965 8:124009533-124009555 CTGGAGACCCAGGGAGAAGATGG + Intronic
1047668503 8:127118994-127119016 CTGTAGTCCCAGCTACAGGAGGG - Intergenic
1047906580 8:129479245-129479267 GTGGGGTCACAGATACAGGAGGG - Intergenic
1048765827 8:137843416-137843438 CTGGAGGCAGAGGTCGAGGAGGG - Intergenic
1049671948 8:143873825-143873847 CTGGAGTGACAGGTCCAGGTGGG - Intronic
1051901301 9:22044702-22044724 ATGGGGATACAGGCACAGGAAGG - Intergenic
1052883216 9:33618502-33618524 CTAGAGACACAGCGCCAGGAGGG + Intergenic
1052999216 9:34568302-34568324 CTGGAGAAATAGGTAAAGGGAGG + Intronic
1053067402 9:35078319-35078341 CTGGAGACACAGGAGCAGCAGGG - Exonic
1056554190 9:87675641-87675663 CTGGAGCCTCAGGGTCAGGATGG + Intronic
1056999301 9:91492854-91492876 CTGGAGCCACAGGTGCTGGAGGG + Intergenic
1057187438 9:93064809-93064831 GTGGAGACACAGGCCCAGGGTGG + Intronic
1057720417 9:97527749-97527771 CTGGGGACACATGGACTGGAGGG + Intronic
1057845110 9:98516900-98516922 ATTCAGACACTGGTACAGGAGGG + Intronic
1058393130 9:104520181-104520203 CTGGTGGCACAGGTATTGGAGGG - Intergenic
1059464893 9:114462201-114462223 CTGTAGACCCAGCTACAGGCAGG - Intronic
1059672790 9:116507347-116507369 ATGGAGAAACAGGCACAGAAGGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059910148 9:119034362-119034384 GTGAAGACACAGGGAGAGGATGG - Intergenic
1060375774 9:123114484-123114506 CAGGAGTCACAGGTACCGGGTGG - Intronic
1061410338 9:130417609-130417631 GTGGAGACAGAGGCAGAGGATGG + Intronic
1061582323 9:131545704-131545726 CTGGCGAGGCAGGTACTGGAGGG + Intergenic
1061703824 9:132437027-132437049 GTGGGGAGACAGGAACAGGAGGG + Intronic
1062176810 9:135167893-135167915 CTGGTGACACCCGCACAGGACGG + Intergenic
1062202415 9:135310514-135310536 CAGGAGACACAGGCACAAGCAGG + Intergenic
1062370841 9:136237758-136237780 CAGGTGACACTGGCACAGGATGG - Intronic
1062430121 9:136523189-136523211 CTGGAGACAAGGGGACAAGAGGG + Intronic
1185699389 X:2218973-2218995 CTGGACAAACAGTTACTGGAGGG - Intergenic
1185942760 X:4339503-4339525 CTGGAAGCACAGGTACAGACTGG - Intergenic
1186270785 X:7885848-7885870 CTGGAAATACTGGTAAAGGAAGG + Intergenic
1186614842 X:11175542-11175564 GAGGAGACCCAGGTATAGGAAGG + Intronic
1187172150 X:16862503-16862525 CTGTAGGCACTGGTATAGGAAGG - Intronic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1189630150 X:42943850-42943872 CTGGTCAAACAGTTACAGGAGGG + Intergenic
1190341514 X:49300132-49300154 CTGGTGGCATAGGCACAGGAGGG + Intronic
1191008159 X:55733124-55733146 CTGGAGACACAGAAACGGGGAGG - Intronic
1191705071 X:64085704-64085726 CTGGTGGCATAGGTACTGGAGGG - Intergenic
1191783704 X:64895018-64895040 CTGGGCACACAGGTGCAGTAAGG + Intergenic
1192503473 X:71667629-71667651 CTGGGGCCACAGGAACAGCAAGG - Intergenic
1193077720 X:77373275-77373297 CTGTCGACACATGTACAGGCAGG + Intergenic
1195272162 X:103242685-103242707 CTGGAGAAAGAGGGTCAGGAGGG - Intergenic
1200125457 X:153811856-153811878 CTGTAGACAAAGGGACATGATGG + Intronic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic
1200268567 X:154660153-154660175 CTGGAGACACAGCTACGGGAAGG - Intergenic
1200835101 Y:7725265-7725287 CTGGGGACTCAGACACAGGATGG + Intergenic
1201273978 Y:12281896-12281918 CTGGACAAACAGTTACTGGAGGG + Intergenic