ID: 1079504326

View in Genome Browser
Species Human (GRCh38)
Location 11:21136340-21136362
Sequence GGCCATGTGGGCCATGGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 2, 1: 0, 2: 9, 3: 28, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079504321_1079504326 -10 Left 1079504321 11:21136327-21136349 CCAGGTCATGTAGGGCCATGTGG 0: 1
1: 0
2: 2
3: 31
4: 248
Right 1079504326 11:21136340-21136362 GGCCATGTGGGCCATGGTAAGGG 0: 2
1: 0
2: 9
3: 28
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079504326 Original CRISPR GGCCATGTGGGCCATGGTAA GGG Intronic
900373080 1:2340894-2340916 GGCCACATAGGCCATGGCAAGGG + Intronic
901216997 1:7560535-7560557 GGCCATCTGGGCCATGAGTAAGG + Intronic
901386048 1:8909954-8909976 GACCTTGTGGGCCATGGTAAGGG + Intergenic
902534770 1:17113345-17113367 GGTCATGTGGGCCATGGGCTTGG - Intronic
903328288 1:22583825-22583847 GACCAGGTGGGCCCTGGAAAGGG + Intronic
905773039 1:40650443-40650465 GGGCTTGTGGGCCTTGGCAAGGG - Intronic
906013336 1:42550433-42550455 GGCCTTATGGGTCATGGTAATGG - Intronic
906647555 1:47486666-47486688 GACCTTGTGTGCCATGGTGAGGG - Intergenic
909319734 1:74268912-74268934 GGCCTTCTAGGCCATGGTATGGG - Intronic
912771809 1:112470985-112471007 GTTCATGTGGGCCAGGGTACTGG + Intronic
913287596 1:117241114-117241136 GGCCTTGTAGGCCATGGTAAAGG - Intergenic
913685509 1:121228149-121228171 AGCCATGTGGGCCTGGCTAATGG + Intronic
914037355 1:144015753-144015775 AGCCATGTGGGCCTGGCTAATGG + Intergenic
914152098 1:145052179-145052201 AGCCATGTGGGCCTGGCTAATGG - Intronic
914461873 1:147892317-147892339 GGCCCTATGTGCCATGCTAAAGG + Intergenic
915745978 1:158158166-158158188 GGCCTTGTGGGCCATTGTAAGGG + Intergenic
915883576 1:159700106-159700128 GGCCATGAGGGCCAGGTAAAGGG + Intergenic
915897193 1:159821346-159821368 GGCCAAGAGGGCCATGGAAAAGG - Intergenic
916281982 1:163061757-163061779 GGCCTTGTTGACCCTGGTAAGGG - Intergenic
916601888 1:166301140-166301162 GGCCTTGAGGGCCATGGGATAGG + Intergenic
918401401 1:184165906-184165928 GGCCATTTGGGCCAGTGTCATGG + Intergenic
918907590 1:190518109-190518131 GGCCTTGTAGACCATGGAAATGG - Intergenic
920472828 1:206246707-206246729 AGCCATGTGGGCCTGGCTAATGG + Intronic
921913773 1:220582515-220582537 AGCTATGTGGGCCATGGACAGGG - Intronic
924506123 1:244685936-244685958 GGCCATGGGGCCCATGGGGATGG - Intronic
924636619 1:245793765-245793787 GGGGCTGTGGGCCATGGTCAGGG - Intronic
1063796182 10:9516398-9516420 GGCCAAGTAGGCCATGGCAATGG + Intergenic
1065258065 10:23894554-23894576 GGCCATGCTGCCCAAGGTAATGG + Intronic
1067068555 10:43116862-43116884 GCCCAAGTGGCCCATGGTAGGGG - Intronic
1067432865 10:46255411-46255433 GGCCTCGTGGGCCCTGGAAAGGG + Intergenic
1067440392 10:46306025-46306047 GGCCTTGTGGGCCCTGGAAAGGG - Intronic
1068307033 10:55224741-55224763 AGCCCTGTAGGCCATGGTATGGG - Intronic
1068908459 10:62352560-62352582 GTCCATGTGGGCCTTGGGATGGG + Intergenic
1072791497 10:98321411-98321433 GGGCTTGTGGGCCGTGGTGAGGG - Intergenic
1074210017 10:111322605-111322627 GGCCATGGGGGTGATGGTAGTGG + Intergenic
1074496955 10:113987700-113987722 GGCCATCTAGGCCATTGTGAGGG + Intergenic
1074543774 10:114386812-114386834 GGCCATGTGGGCCTCGGTCCTGG + Intronic
1076358360 10:129869023-129869045 GGCCATGTAGGCCTCTGTAATGG + Intronic
1076774804 10:132689266-132689288 GGCCCTGTGTGACCTGGTAACGG + Intronic
1077849806 11:6064483-6064505 GGTCTTTTGGGCCATGTTAAAGG + Intergenic
1078518224 11:12042977-12042999 GTCCATGTGGGTTATGGAAATGG + Intergenic
1079504326 11:21136340-21136362 GGCCATGTGGGCCATGGTAAGGG + Intronic
1080393840 11:31871966-31871988 AGGCAGGTGTGCCATGGTAAGGG + Intronic
1080696289 11:34605772-34605794 GGCCATGTGGACCAAGGCAGTGG + Intergenic
1081729765 11:45362210-45362232 GGTCTTTTGGGGCATGGTAAAGG - Intergenic
1083032023 11:59601639-59601661 GGCAATGTGGGTTCTGGTAAAGG - Exonic
1083533680 11:63448819-63448841 GACAATTTGGGCCATGGCAAAGG - Intergenic
1083889538 11:65589007-65589029 GGCCATGTGGGGCAGTGCAATGG + Intronic
1084977540 11:72810872-72810894 GGCCTTGAAGGCCATGGTAAAGG + Intergenic
1085326486 11:75610551-75610573 GGCCATGCCAGCCATGTTAAGGG + Intronic
1088356393 11:108948576-108948598 GGCCTTGTAGGCTATGGAAAAGG - Intergenic
1088500161 11:110474840-110474862 GGCCCTGTAGGCCAGGGCAAGGG + Intergenic
1088619657 11:111669119-111669141 GACCATGTGAGTCATAGTAAAGG - Intronic
1089580790 11:119480978-119481000 GACCCTGTGGGCCATGGCGAGGG - Intergenic
1094091928 12:26660230-26660252 ATCCTTGTGAGCCATGGTAAAGG + Intronic
1095284314 12:40389921-40389943 GGCCTTGTAAGCCATGTTAATGG + Intergenic
1095962950 12:47846709-47846731 GGACATGTCGTCCATGGTGAAGG + Exonic
1096006418 12:48176628-48176650 GCCCATGTGTGCTATGGTGATGG + Intronic
1096394414 12:51254940-51254962 GGCCTTGTAGGCCAAGGTAAGGG + Intronic
1096684071 12:53276401-53276423 GGCCTTATAGGCCATGGTCAGGG + Intronic
1097014791 12:55978052-55978074 GGCCATCTGAGGCATAGTAACGG + Intronic
1098420587 12:70292663-70292685 GGCCTTGGAGGCCTTGGTAATGG + Intronic
1098519213 12:71416771-71416793 GACCCTGTAGGCCATGTTAAGGG + Intronic
1101944025 12:109122128-109122150 GGCCATGTAGACCATGGAAAGGG + Intronic
1103329625 12:120145019-120145041 GGCCCTTGGGGCCATGGTGAAGG - Exonic
1104001747 12:124864351-124864373 GGGCATGTGGACCGTTGTAAGGG - Intronic
1104002404 12:124868615-124868637 GATCTTGTGGGCCATGGTGAGGG - Intronic
1106793685 13:33182875-33182897 GGCACTGTGGGCCGTGGTGATGG - Intronic
1110668316 13:78144226-78144248 GGCCATGTGGGTCATGTTTCTGG - Intergenic
1111173449 13:84560932-84560954 GGCCATGATGCCCATGCTAAAGG + Intergenic
1112442638 13:99435326-99435348 GGCAGTGTGGACCATGGTAGGGG - Intergenic
1115734402 14:36309003-36309025 GGCCTTGTAGGCCATTGTGAGGG - Intronic
1115900796 14:38145322-38145344 AGTCATGTGAGCCATGTTAATGG + Intergenic
1119078436 14:71668211-71668233 GGCCATGTGACCCATGTGAATGG + Intronic
1121210135 14:92202295-92202317 GGCCTGGTGGGCCATAGTGAAGG + Intergenic
1122773452 14:104107113-104107135 GGCCAGGTAGGCCATGGGGAGGG - Intronic
1124020841 15:25921518-25921540 GGCCATGATGGCCACGGTGAAGG - Intergenic
1124957098 15:34366913-34366935 GGCCATTTGAGCCCTGGCAAAGG - Intronic
1125188942 15:36966988-36967010 GGGCCTGTGGGTCATGTTAAAGG + Intronic
1128369838 15:67032657-67032679 GGCCGTGTAGGTCAGGGTAAGGG - Intergenic
1128526766 15:68417625-68417647 GGCCTGGTGGGCCCTGGGAAGGG - Intronic
1128983237 15:72201148-72201170 GGCCATGTGGGGCAGGGAGAGGG - Intronic
1129684613 15:77677921-77677943 TGCCCTGTGGGCCAGGTTAAGGG - Intronic
1129687200 15:77693502-77693524 GGCCCTGAGGGCCAGGGTAAGGG + Intronic
1130175482 15:81564894-81564916 GATCTTGTGGGCCATTGTAAAGG - Intergenic
1130730928 15:86491390-86491412 GGCCTTGTAGGCCTTGCTAAGGG + Intronic
1132684445 16:1156458-1156480 GCCCATGTGGGCCATGGCTGAGG + Intronic
1133741986 16:8658811-8658833 GGCCTTGTGGGCCCTGCAAAGGG - Intergenic
1134174814 16:11997103-11997125 GATCGTGTGGGCCATGATAAAGG - Intronic
1135868972 16:26131367-26131389 GGCCTTATGGGCCATGGAAAAGG - Intronic
1135969391 16:27061326-27061348 GGCCCTGTGGGCCGTGGAAAGGG - Intergenic
1139381441 16:66534485-66534507 AGCCTTGTGGGCCATGATAAGGG - Intronic
1139424651 16:66871967-66871989 GGCCTTGTGGGCCAAAGGAAGGG - Intronic
1139607909 16:68033024-68033046 GGCCTTGTGGGCCATTAGAAAGG + Intronic
1139789808 16:69424588-69424610 GGCCTTATGGGCCCTGGTTACGG + Exonic
1140636474 16:76920654-76920676 GGCCTTGGAGGCCATGGTAAAGG + Intergenic
1140777034 16:78258743-78258765 AGCCATGTGGGCCTTGGCTAGGG - Intronic
1141076380 16:81009474-81009496 GGCCTTGTAGACCATGGTGAAGG + Intronic
1141999463 16:87655925-87655947 GGGCATGTGGGCAAAGGGAACGG - Intronic
1142177268 16:88650974-88650996 GGCCATGTGGGCCAACGAACAGG - Exonic
1143103959 17:4519311-4519333 GGCCATGTGTGCCATGGGGATGG + Intronic
1145110037 17:20154573-20154595 GGCCTTGGAGGCCATTGTAAGGG + Intronic
1146462165 17:33054951-33054973 GGCCATGTGGCCAATGGTGATGG - Intronic
1147345223 17:39787830-39787852 GGCCTTGCAGGCCATTGTAAAGG - Intronic
1148183999 17:45628217-45628239 GGTAATGTGAGCCATGGGAATGG + Intergenic
1148841726 17:50503024-50503046 GCACATGTGGGCCATCCTAATGG - Intergenic
1149575435 17:57708426-57708448 GCCCTTGTGTGCCAAGGTAAAGG - Intergenic
1150122964 17:62618638-62618660 GGGCATGTGAGCCAGGCTAAAGG - Intergenic
1155110802 18:22712516-22712538 GGCCCTGTGGGCCTTGGTGGTGG - Intergenic
1156294141 18:35774623-35774645 GGCCTTCTAGGCCATGGTGAAGG - Intergenic
1156470681 18:37375699-37375721 GGCCAGGTGGGCAGTGGTACAGG - Intronic
1157330778 18:46702397-46702419 GGCCATGAGAGCCACGGGAATGG - Intronic
1160802113 19:974931-974953 GGCCATGCTGGCCGTGGAAATGG + Exonic
1161001352 19:1912674-1912696 GGCCGTGGGGGCCGTGGTAGTGG + Exonic
1161421997 19:4181101-4181123 GGCCTGGTGGGCCGTGGGAAGGG - Intronic
1161851176 19:6738930-6738952 GGCCATCTGGGCCCTGGAGAAGG - Intronic
1162487451 19:10969919-10969941 GGCCTTGAGGGCCACAGTAAAGG - Intronic
1163759700 19:19129352-19129374 GGTCATGTGGGCCATGGTGAGGG + Intronic
1165783921 19:38449857-38449879 GGCCTTGTGGGCCATGGGAGAGG + Intronic
1166220263 19:41359844-41359866 GGCCACGTGGGCCATGGTGGAGG - Intronic
1166309611 19:41955649-41955671 AGCCTTGTGGGCCACGGTGAGGG - Intergenic
1166601684 19:44101295-44101317 GGCCATTTAGGCCAGGGCAATGG - Intronic
1166647539 19:44543334-44543356 GGGCCTGTGGGCCATGATGAGGG - Intergenic
925425721 2:3747455-3747477 GGCGAAGTGGGCCATTGTCATGG + Intronic
925836379 2:7950930-7950952 GGCCATGTGACACCTGGTAAGGG + Intergenic
926705153 2:15831964-15831986 GGCCATGAGTTCAATGGTAAGGG - Intergenic
927030981 2:19120127-19120149 TGCCAGGTGGGCAATGGCAATGG - Intergenic
930099907 2:47595541-47595563 GGCCATTTGGGCCAGATTAAGGG + Intergenic
930562912 2:52983099-52983121 GGCCCTGTGAGCCATGGTAAGGG + Intergenic
932235984 2:70121478-70121500 GGCCATGTGGGCCACAGGAGAGG - Intergenic
933553333 2:83802777-83802799 GGCCACGTGGGCAGCGGTAATGG - Intergenic
933808030 2:86014237-86014259 GTAGATGTGGGCCATGGGAAGGG + Intergenic
936171780 2:110183221-110183243 GGCCATGATGCCCATGGTGAAGG + Intronic
937589418 2:123595128-123595150 AGTCATGTAGGCCTTGGTAAAGG + Intergenic
938099432 2:128488195-128488217 CGCCATGTGGGGCATGGGATAGG + Intergenic
939650857 2:144760008-144760030 GGCCATATGGACCATGGCAAGGG - Intergenic
944383784 2:199141636-199141658 GGCCATGTGTGCCTTGGAAAAGG - Intergenic
946352686 2:219165578-219165600 GACCTTGTAGACCATGGTAAAGG - Intronic
948780086 2:240314411-240314433 GGGCATGGGGGCCATGGGAAGGG + Intergenic
1170261615 20:14414655-14414677 GGCCTTGACGGACATGGTAAGGG - Intronic
1172316909 20:33962732-33962754 GGACATATAGGCCATGGAAATGG - Intergenic
1172770182 20:37377643-37377665 GGCCATGTGGACCCAGGTGATGG + Intronic
1173514063 20:43652559-43652581 GGCCATGTGAGCCATGGCCATGG + Intergenic
1173691432 20:44964166-44964188 GACCATGTGGGTCATGCAAATGG + Intergenic
1173702115 20:45081834-45081856 GGCCTTGTGGTCCATGGGAAGGG + Intergenic
1173789485 20:45818511-45818533 TGCCATGTGGTCCTTGGTCACGG + Intergenic
1174201339 20:48808678-48808700 GGCCTTGAGGGCCATTGTAAGGG - Intronic
1174373199 20:50108042-50108064 GGCCTTGTGGGCCATGGAAAAGG + Intronic
1176515693 21:7781775-7781797 GGCCCTGTGTGCCATGGGCAAGG + Intergenic
1177762267 21:25415153-25415175 GGCCAGGTGGGGCCTGGTAGAGG - Intergenic
1178649721 21:34411787-34411809 GGCCCTGTGTGCCATGGGCAAGG + Intergenic
1179048581 21:37869226-37869248 GGCCGTGGAGGCCATGGAAATGG - Intronic
1179084600 21:38206272-38206294 GGCCATGAGGGACCTGGAAATGG + Intronic
1179614037 21:42570172-42570194 GGCCATGTGTCACATGGCAATGG - Intronic
1179855152 21:44159486-44159508 GGCCATGGGGGGCAGGTTAAGGG - Intergenic
1180188629 21:46152231-46152253 GAACATGTGGGACATGCTAACGG + Intronic
1182042697 22:27250681-27250703 GACTTTGTGGGCCATCGTAAGGG + Intergenic
1182142379 22:27972222-27972244 GGACATGTTGGCCATGGAGAGGG + Intergenic
1182299865 22:29331356-29331378 GTCCATCTGGACCTTGGTAAAGG + Intronic
1182404865 22:30118176-30118198 GGCCTTGTTGGCTATGGTAAGGG - Intronic
1183702707 22:39458734-39458756 GGCGTTGTGGGCCAAGGGAATGG + Intronic
1183868846 22:40725285-40725307 TGCCATCTGCGCCATGGAAAGGG + Intergenic
1184499186 22:44861663-44861685 GGCCATGTGGACCAACGTGAGGG - Intronic
1184528612 22:45040415-45040437 GGCCAGGTGGGCAGTGGGAATGG - Intergenic
1184652468 22:45925486-45925508 GGGCATCTGGGCCAAGGTCATGG + Intronic
949652820 3:6180522-6180544 GGCCTTGTGAGCCAGGGTAGGGG + Intergenic
953368547 3:42367579-42367601 GGCAATGGGAGCCATGGCAAAGG + Intergenic
957744204 3:84317698-84317720 AGCCAGGTGGGCCTTGGTGAGGG + Intergenic
958442696 3:94175642-94175664 AGCCCTGTGGGCCAAGGAAAAGG + Intergenic
960180388 3:114568945-114568967 GGCCAGGTGGGCTATGGCAGGGG - Intronic
961060407 3:123823741-123823763 GGCCGTGTAGGCCATGGTAAGGG - Intronic
962448597 3:135492251-135492273 GGCCTTATAGGCCATGGGAAAGG + Intergenic
963940489 3:151091729-151091751 GGCCTTGAAGGCCAAGGTAAAGG - Intronic
964024589 3:152057482-152057504 GTGCATATGGGACATGGTAATGG - Intergenic
966610408 3:181862497-181862519 GGCCATGTGCGCCATGTCACAGG - Intergenic
967227414 3:187305328-187305350 GGCCTTGTAAGCCATGGTCAGGG + Intergenic
968807918 4:2787295-2787317 GCCCATGTGGGGCTTGGGAAGGG - Intergenic
969117031 4:4877032-4877054 GGACTTGCGGGCCAGGGTAAGGG - Intergenic
969195790 4:5562853-5562875 GGCCATGAGGGCCTTGGGCATGG - Exonic
969339760 4:6532769-6532791 GGCCATGTGGGTGATGGTGGTGG - Intronic
970867942 4:20780604-20780626 AGCCCTGTGGCCCATGGAAATGG - Intronic
972608596 4:40636302-40636324 GGCCGTGGAGGCCATGGTTAGGG - Intergenic
975343325 4:73265666-73265688 GGGCCTGTGGACCATGCTAAGGG + Intergenic
977940747 4:102855804-102855826 GTTCATGTGGGACATGGCAAGGG + Intronic
979425768 4:120563655-120563677 GGCCATGTGGGACAGGGCAGGGG - Intergenic
981576701 4:146213280-146213302 TGCCAGGTGGCCCAGGGTAATGG + Intergenic
981725702 4:147844960-147844982 GGCCTTGTGGGCTCTGGGAAAGG - Intronic
981819380 4:148868263-148868285 CGCCATGAGGGCCATGGCCACGG + Intergenic
981918051 4:150056394-150056416 GGCCTTGTAGACAATGGTAAAGG + Intergenic
983099766 4:163610758-163610780 GGCCATGTGAAACATGCTAAAGG - Intronic
985205499 4:187530963-187530985 GGCCATGTGGGGAAAGGGAAGGG - Intergenic
992548284 5:77836886-77836908 GGTCATGTAGACCATGGTGAGGG - Intronic
994633174 5:102311342-102311364 GGCTTTGTGGGCCATGGGAATGG - Intergenic
994793729 5:104265992-104266014 TGTCATCTGGGGCATGGTAATGG - Intergenic
995711087 5:115036463-115036485 GGCCATGATGCCCATGCTAAAGG - Intergenic
996075876 5:119193202-119193224 GGTCTTGTAGGCCATGGTAAAGG - Intronic
998370449 5:141657396-141657418 GGCCATGTGGGCCATGGTAAGGG + Intronic
1000364516 5:160478539-160478561 GGCCTTGTAGGCCATGCTGAGGG + Intergenic
1001455789 5:171858731-171858753 GGCCCTGTGGGCCATTCTGAGGG - Intergenic
1004635339 6:17462176-17462198 TGCCATTTGGGCCCTGGTAGAGG - Intronic
1005373302 6:25157014-25157036 GGCCCAGAGGGCCATGGTGATGG - Intergenic
1006145615 6:31957843-31957865 ATTCATGTGGGCCATTGTAATGG - Intronic
1008537568 6:52518375-52518397 GGCCTTGTGTGCCATGTAAAAGG + Intronic
1012783455 6:103592219-103592241 GGCCTTGTAGGCCATTGTAAAGG - Intergenic
1013184692 6:107747169-107747191 GTCCATGTGGGCCACCATAATGG - Intronic
1014175588 6:118327724-118327746 GCCCTTGTGTGCCATGGTCAGGG - Intergenic
1014513847 6:122357755-122357777 CACCATGTTGGCCATGGTGAAGG - Intergenic
1016841040 6:148525803-148525825 GGCCATGTGGGGCCAGGTACTGG - Intronic
1018068162 6:160138064-160138086 GGCCTTGTGGGCCACAGAAAAGG - Intronic
1019179671 6:170178374-170178396 GGCCATGTTGGCCACGGGCAGGG + Intergenic
1020079474 7:5279665-5279687 GGTCTTGTTGGCCATGGTGAGGG - Intronic
1021821974 7:24507171-24507193 GGCCGTGAGGGCCAAGTTAAAGG + Intergenic
1023133499 7:37027344-37027366 GGGCAGGTGGTGCATGGTAAAGG - Intronic
1024829479 7:53432762-53432784 GCCCTTGTAGACCATGGTAAGGG + Intergenic
1025199420 7:56952531-56952553 GGTCTTGTTGGCCATGGTGAGGG + Intergenic
1025672528 7:63624402-63624424 GGTCTTGTTGGCCATGGTGAGGG - Intergenic
1025823683 7:64994166-64994188 GGCCGAGTGGGCCATTGTCATGG + Intronic
1028106797 7:86888166-86888188 GTCCATGTGGGCCATGATAGGGG - Intronic
1029606978 7:101605181-101605203 AACTGTGTGGGCCATGGTAAAGG - Intergenic
1031662471 7:124443080-124443102 GGCCTGGTGTGCCATGCTAAAGG + Intergenic
1031895635 7:127345678-127345700 GGCTATGTGAGCCATGGTAAAGG + Intergenic
1032511470 7:132475833-132475855 GTCCATCTGGGCAATGGTCAGGG + Intronic
1035153723 7:156895331-156895353 GACCACATGGGCCATTGTAACGG + Intergenic
1039593102 8:38767359-38767381 TGCCCCGTGGGCCATAGTAATGG + Intronic
1039957938 8:42221583-42221605 GGCACTGTGAGCCATGCTAAGGG + Intergenic
1043728970 8:83650677-83650699 GGCAATGTCTGCCATGGTCAGGG + Intergenic
1044275353 8:90293084-90293106 GGCCACGTGGGCCATGGAAAGGG - Intergenic
1044620777 8:94188717-94188739 CCCCATGTGGGCCATTGTCAAGG - Intronic
1046357470 8:113107244-113107266 GACCATGTGGGTCATGCAAACGG + Intronic
1047710925 8:127551567-127551589 GGCCATGTAGGGCACTGTAAAGG - Intergenic
1047832385 8:128649116-128649138 GACCCTATGGACCATGGTAAAGG - Intergenic
1047971868 8:130091514-130091536 GGCCCTGTGGGCCTTGATATAGG + Intronic
1049422812 8:142524409-142524431 GGCCATGAGGGCCATCCTGAAGG - Intronic
1051882648 9:21855586-21855608 GGCCATACAGACCATGGTAAGGG + Intronic
1053380832 9:37648959-37648981 GGACATGAGGGCAATGGTAAAGG + Intronic
1055985107 9:82050365-82050387 GGCAATATGTGCCATGGTCAAGG - Intergenic
1058814729 9:108672569-108672591 GGCCTTGTGATTCATGGTAAAGG - Intergenic
1060127370 9:121061348-121061370 TGCCATGTTGGCCAAGGTAGAGG - Intergenic
1060585701 9:124784124-124784146 GGCCTTGAAGGCCACGGTAAGGG + Intronic
1061866314 9:133493397-133493419 GGCCCTGCAGGTCATGGTAAGGG + Intergenic
1062004216 9:134231208-134231230 GCCCATGGAGGCCATGGTATGGG + Intergenic
1062432658 9:136532943-136532965 GGCCAGGTGGGCAGTGGGAATGG - Intronic
1186656143 X:11614089-11614111 GGCTAGGTGGGCCGTGGAAAAGG - Intronic
1187993558 X:24901504-24901526 AGCCATGTAAGCCATTGTAAGGG + Intronic
1192537326 X:71939256-71939278 GACCATGTAAGCCATGTTAAGGG + Intergenic
1196100607 X:111843639-111843661 GGCCCTGTGTGTTATGGTAAAGG + Intronic
1197599243 X:128508170-128508192 GCCCATTTGAGCCATGGTTAGGG - Intergenic
1199983511 X:152934192-152934214 GACCCAGTGGGCCATGGGAAAGG - Intronic
1202168619 Y:22017904-22017926 GGCCAAGTGGGCCCTTGTCATGG - Intergenic
1202222742 Y:22568464-22568486 GGCCAAGTGGGCCCTTGTCATGG + Intergenic
1202320373 Y:23627196-23627218 GGCCAAGTGGGCCCTTGTCATGG - Intergenic
1202550394 Y:26042860-26042882 GGCCAAGTGGGCCCTTGTCATGG + Intergenic