ID: 1079505035

View in Genome Browser
Species Human (GRCh38)
Location 11:21143806-21143828
Sequence TGATGGGTATTCATCTTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079505035 Original CRISPR TGATGGGTATTCATCTTGCC GGG (reversed) Intronic
904999435 1:34656886-34656908 TGTTGTGTATTGATCCTGCCGGG - Intergenic
905950189 1:41944501-41944523 TTATGGGAATGCATCTTGACGGG + Intronic
905961691 1:42048259-42048281 TGATGGACACTCATCTTTCCAGG - Intergenic
907557259 1:55355132-55355154 TGAAGGGTGTACATCCTGCCTGG + Intergenic
907616421 1:55931277-55931299 TGATGGGAATTCAGCAGGCCTGG + Intergenic
909018625 1:70406612-70406634 TGCAGGGCATTCATCTTCCCTGG - Intergenic
909438605 1:75672891-75672913 AGCTGGTTATTAATCTTGCCAGG - Intergenic
911838891 1:102656813-102656835 TGATAGGAATTAATCTTCCCTGG - Intergenic
912757787 1:112338988-112339010 TGATGGAAATTCATCTTAGCAGG - Intergenic
917663198 1:177197692-177197714 TGGTGGGTATGCATCTTGGTCGG - Intronic
920199263 1:204249431-204249453 AGATGGGTCTTCATCTTGGGAGG + Intronic
921252041 1:213307364-213307386 TGAAGGGTTTTCCTCTTGTCAGG + Intergenic
1065438714 10:25727489-25727511 TGATGAGTTTTAATCTTCCCTGG + Intergenic
1071139786 10:82495126-82495148 AGATGGGGTTTCATCATGCCAGG + Intronic
1072902331 10:99419516-99419538 GGAAGGATATTCATCTTGCATGG - Intronic
1076772007 10:132670874-132670896 TGATGGATATTCATGTGGTCAGG + Intronic
1079505035 11:21143806-21143828 TGATGGGTATTCATCTTGCCGGG - Intronic
1081402675 11:42661435-42661457 TGATGGGTATGGCTCTGGCCAGG + Intergenic
1083919341 11:65773361-65773383 TGATGGGTAGTCACCTTGTCAGG + Intergenic
1084627560 11:70320244-70320266 TGAAGGGTATTTCTCTTGCTTGG - Intronic
1088687202 11:112294952-112294974 TGAAGGGCATTCATCTTGTGCGG + Intergenic
1090406110 11:126476592-126476614 TGCTGGGTATTCATGTAGCCAGG + Intronic
1101128768 12:101666865-101666887 TGATGAGTATTCTTCATGCTTGG - Intronic
1103189136 12:118985676-118985698 AGAAGGGTAGTCATTTTGCCTGG + Intronic
1103848266 12:123914686-123914708 TGCTGGGTTTGCAGCTTGCCCGG - Intronic
1108764238 13:53607197-53607219 TAATGGGTATACAGCTGGCCTGG - Intergenic
1112229832 13:97578354-97578376 TTCTTGGTATTTATCTTGCCAGG - Intergenic
1114066080 14:19060637-19060659 TGAAGGGCATTCATGTTTCCAGG - Intergenic
1114173557 14:20298757-20298779 TGTTGCCTATTCATCTGGCCTGG + Intronic
1115840846 14:37468886-37468908 TGAAGGTTATTCATCCTGACTGG + Intronic
1117302004 14:54439470-54439492 TGATGGGTATTCCTTTTTTCTGG - Intronic
1120319292 14:82938898-82938920 TGATGTGTATTAATCTTGCATGG - Intergenic
1123488820 15:20764177-20764199 TGAAGGGCATTCATGTTTCCAGG + Intergenic
1123545319 15:21333264-21333286 TGAAGGGCATTCATGTTTCCAGG + Intergenic
1202953664 15_KI270727v1_random:60535-60557 TGAAGGGCATTCATGTTTCCAGG + Intergenic
1137223075 16:46474621-46474643 TGATGGCTATACAACTTTCCTGG - Intergenic
1139576266 16:67844049-67844071 TGATGGAGATCCAGCTTGCCAGG + Exonic
1140312574 16:73863940-73863962 TGATGGGTACTTGTCTTGCTTGG - Intergenic
1144144195 17:12381420-12381442 TGATAGGTTTTCATTTTACCAGG + Intergenic
1147042166 17:37727438-37727460 TGCTGGGCCTTCATCTTTCCAGG - Intronic
1153215238 18:2813968-2813990 TCCTGAGCATTCATCTTGCCTGG - Intergenic
1155798852 18:30074407-30074429 TGCTGGGTTTTGAACTTGCCTGG + Intergenic
1157259234 18:46164413-46164435 CCATGGGAATTCATCTTTCCTGG - Intergenic
1162925596 19:13929441-13929463 AGGTGGGTATCCATCCTGCCGGG + Exonic
930229151 2:48826511-48826533 TGGTGGGTCATCATCCTGCCCGG - Intergenic
930531361 2:52592398-52592420 TGATCAGTATTCACCATGCCTGG - Intergenic
933456011 2:82520230-82520252 TGGTGGGTAGTTACCTTGCCTGG - Intergenic
940180049 2:150921927-150921949 AGATGGGAACTCATATTGCCTGG - Intergenic
946190869 2:218007258-218007280 TAATTGGTATTAATCTTTCCTGG - Intergenic
1169689655 20:8316378-8316400 TGCTGGGAATTCACCTAGCCTGG + Intronic
1175686718 20:61034924-61034946 AAATGGATAGTCATCTTGCCAGG - Intergenic
1180484560 22:15783229-15783251 TGAAGGGCATTCATGTTTCCAGG - Intergenic
952586414 3:34898270-34898292 AGATGAGAATTCATCTTGGCAGG + Intergenic
955036968 3:55277528-55277550 TGATGTGTATTCACTTTTCCAGG - Intergenic
956462766 3:69487818-69487840 TACTGGGTATTCATCTTCCCAGG - Intronic
956595236 3:70959923-70959945 AGATGGGTATTCATCCACCCAGG - Intronic
957499345 3:81033822-81033844 TGATGGGTATGCTTGTTGGCTGG - Intergenic
958179815 3:90045981-90046003 TGCTGGTTATTCATTTTGCTGGG - Intergenic
960454534 3:117854291-117854313 TCATGAGTTTTCTTCTTGCCTGG + Intergenic
963152281 3:142057904-142057926 TGATTGGTATTGAACTGGCCTGG - Intronic
967431555 3:189391712-189391734 TCATGGATATTCATCCTCCCTGG + Intergenic
967902842 3:194474343-194474365 TGAGGTCTCTTCATCTTGCCAGG + Intronic
971067135 4:23045719-23045741 TGAGGGATATTCATTTGGCCTGG + Intergenic
973980117 4:56301505-56301527 TGGTGGCTAATCAGCTTGCCAGG - Intronic
974806769 4:66890756-66890778 TGATGGGTATACCTTTTGACTGG - Intergenic
975262948 4:72326360-72326382 TGACTGCTTTTCATCTTGCCAGG + Intronic
978036867 4:104005660-104005682 TGATGGCTAATCTTCTGGCCTGG + Intergenic
981680369 4:147390587-147390609 GGATGGGTATTAATATTCCCTGG + Intergenic
983850620 4:172576266-172576288 TGCTGGGTATTCATCTACACAGG + Intronic
987599218 5:20043633-20043655 TAATAGGTAGTCATGTTGCCAGG + Intronic
994785732 5:104159868-104159890 TGAATGCTATTCATCTTGCCAGG + Intergenic
997966667 5:138362354-138362376 TGATAGGAATTAATCTTCCCTGG - Intronic
1006568572 6:34981350-34981372 TTATTGGTATTCATCTTGCCAGG + Intronic
1010524958 6:76889663-76889685 TTATGTGTATTCATTTTTCCTGG - Intergenic
1011504576 6:88027957-88027979 TGCTGGGTTTTGATCTTGCATGG - Intergenic
1017116384 6:150980974-150980996 TGTTAGGTATTTCTCTTGCCCGG - Intronic
1020042440 7:5014284-5014306 GAATGGGTATTCCTCTTGTCAGG - Intronic
1020507979 7:9018061-9018083 TTATGGGAATGCATCTTGACGGG + Intergenic
1022509842 7:30928148-30928170 TCAAGGGGATTCATCTTTCCTGG + Intergenic
1028892511 7:96003721-96003743 TGGTGGGGACTCATCTGGCCTGG - Intronic
1046219451 8:111193853-111193875 TGTTTGGAATTCATCTTGCTGGG - Intergenic
1050314702 9:4389411-4389433 GGAAGGGGATTCATTTTGCCTGG + Intergenic
1051019029 9:12517637-12517659 CCATGGGTATTCATCTTGCATGG + Intergenic
1052529116 9:29658168-29658190 TGATGGGAATACATCTTGATGGG - Intergenic
1054926295 9:70591957-70591979 TGATGGATTTTCATCTTGACAGG + Intronic
1055783633 9:79847659-79847681 TTCTGAGTATTCATCTTTCCAGG + Intergenic
1057466642 9:95320057-95320079 TTATAGGGATTCATTTTGCCTGG + Intergenic
1057539142 9:95948610-95948632 TTCTGGGTATACATCCTGCCTGG - Intronic
1061352462 9:130076441-130076463 TGATGGCTTTTCTTCTTACCTGG + Exonic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1190495608 X:51025780-51025802 TGATGGGTCTGCATCTGCCCAGG + Intergenic
1192715547 X:73638081-73638103 TTCTGAGTATGCATCTTGCCTGG + Intronic
1194077228 X:89411211-89411233 TGATGTGTATTCATCTGTCAAGG - Intergenic
1194120063 X:89950614-89950636 TGATGGGTTTTGAACTTGCATGG - Intergenic
1195859068 X:109361342-109361364 AGCTGGGTATTCATATAGCCTGG - Intergenic
1200472925 Y:3608132-3608154 TGATGGGTTTTGAACTTGCATGG - Intergenic