ID: 1079508511

View in Genome Browser
Species Human (GRCh38)
Location 11:21182831-21182853
Sequence CTCTTCAAATGTTGGGAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 320}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079508505_1079508511 15 Left 1079508505 11:21182793-21182815 CCAGCTGATATTGTTATCTGAGG 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1079508511 11:21182831-21182853 CTCTTCAAATGTTGGGAAAACGG 0: 1
1: 0
2: 2
3: 24
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079508511 Original CRISPR CTCTTCAAATGTTGGGAAAA CGG Intronic
900738781 1:4317633-4317655 CTCCTCATCTGTTGGGAAAGTGG + Intergenic
901586378 1:10297262-10297284 CTGCTAAACTGTTGGGAAAAGGG + Intronic
902128252 1:14236117-14236139 TTCTTCAGATGTAGGGACAATGG + Intergenic
902957053 1:19932697-19932719 AACTTAAATTGTTGGGAAAAGGG - Intergenic
904212854 1:28897289-28897311 CTCCTAAAATGTTGGGATTACGG - Intronic
904949660 1:34226269-34226291 GTTTGCAAGTGTTGGGAAAATGG + Intergenic
905374728 1:37512494-37512516 ATCTTCAAATTATAGGAAAATGG - Intronic
905711970 1:40112921-40112943 CTCTTCAAGTGCTGGGATTATGG - Intergenic
907778864 1:57545537-57545559 CCCTTCAAATGTTGGGCTCAAGG + Intronic
909832451 1:80209761-80209783 ATATTTAAATGTTGGGCAAAAGG + Intergenic
910808142 1:91208884-91208906 CTCATCAAAAGTTGGGAAAAAGG - Intergenic
911547668 1:99239319-99239341 CTCATGAAATATTGGGAGAAGGG - Intergenic
913228750 1:116723415-116723437 CTCTTGAAATGTTGGCAGCATGG + Intergenic
913507222 1:119528013-119528035 GTCTTCACATGGTGGGAGAATGG + Intergenic
915205387 1:154266864-154266886 CTCTTGAAAAGTTATGAAAAAGG - Intronic
915750316 1:158202857-158202879 CTTTTCTTATGTTGGGAACAAGG + Intergenic
915779765 1:158534558-158534580 ATAGTCCAATGTTGGGAAAAAGG + Intergenic
916319530 1:163488142-163488164 CTCTGCTAAGGTTGGAAAAAAGG - Intergenic
917180326 1:172289221-172289243 CTCTTAAAATCTAGGGAAAAAGG + Intronic
917533285 1:175855922-175855944 CTCTTCAGATGGTGGGGGAACGG - Intergenic
918685127 1:187405171-187405193 CTATACAAATGTTGGAAAGAGGG - Intergenic
918779417 1:188678437-188678459 ATATGCAAATGTTGGGTAAATGG + Intergenic
919275744 1:195414237-195414259 CTCAAGAATTGTTGGGAAAAAGG - Intergenic
919348468 1:196417653-196417675 ATATTCAAAGGATGGGAAAAGGG - Intronic
920078029 1:203351181-203351203 CTAATCAAATATTGTGAAAAGGG + Exonic
920574185 1:207044722-207044744 CTTTAAAAATGTTTGGAAAAGGG + Exonic
920847317 1:209605074-209605096 CTCTTCTCATTTTGGGAAATTGG - Intronic
920883328 1:209900327-209900349 TTCTGTAAGTGTTGGGAAAATGG - Intergenic
921778485 1:219131519-219131541 CTCTCAAACTGTTGGGAAACAGG + Intergenic
922046746 1:221952434-221952456 CTATTCATATGATGGGAAATGGG + Intergenic
922778550 1:228230319-228230341 CTTTTCAAATTTTGGAAAAAAGG + Intronic
923389886 1:233503732-233503754 CTCTGCCAGTGTTGGGAATATGG - Intergenic
1065475579 10:26134186-26134208 CTCTTCAAATTTTAGTAAAATGG + Intronic
1065853889 10:29814239-29814261 GTCCTCCAATGTTGGGAACAGGG - Intergenic
1067421627 10:46156687-46156709 CTCTTCAATTGATTGGATAAGGG - Intergenic
1068393347 10:56427528-56427550 CTCTTCAATTGATTGGATAAGGG + Intergenic
1069127718 10:64658418-64658440 GGCTTCAAATGTTTTGAAAATGG + Intergenic
1070859108 10:79635829-79635851 CTCTTCAATTGATTGGATAAGGG - Intergenic
1070943911 10:80372394-80372416 CTCTTGAAGTGTTGGGATTACGG - Intergenic
1071366593 10:84906771-84906793 CTCCTCTAGTGTTGGGAAACAGG + Intergenic
1073568443 10:104555624-104555646 CTCCTCAAATGGTGAGAACAGGG + Intergenic
1073982641 10:109172527-109172549 CTCTTGAAATCTTGGGAGAATGG - Intergenic
1074005105 10:109413814-109413836 TGCTTCAAATGATGGGAAATGGG + Intergenic
1074294653 10:112172921-112172943 CTCTACAATTGAGGGGAAAATGG + Intronic
1077512428 11:2975471-2975493 CTCTCAAAATGCTGGGATAACGG - Intronic
1078134196 11:8638653-8638675 CTCTCCAAATGTGGTGAGAAAGG - Exonic
1079508511 11:21182831-21182853 CTCTTCAAATGTTGGGAAAACGG + Intronic
1080229933 11:30008943-30008965 CTCTACAAATGGTGGGGAAAGGG + Intergenic
1083473103 11:62897594-62897616 CTCTTCAGACGTTGGAGAAATGG + Intergenic
1085322181 11:75582162-75582184 CTCTTGAAGTGGGGGGAAAAGGG - Intergenic
1086793577 11:91072115-91072137 GTCTTGAAATCTTGGGAATAAGG - Intergenic
1086813008 11:91334479-91334501 CTGTTCAGTTGTTGGGGAAAAGG - Intergenic
1086992501 11:93319453-93319475 CTGTTCAAATAGTGGAAAAATGG - Intergenic
1089339877 11:117750113-117750135 CTCGGGAAATGTTGGGTAAAGGG + Intronic
1090615824 11:128513792-128513814 CTCCTAAAATGTTGGGATTACGG - Intronic
1091439248 12:499823-499845 CTCTTGAAAAGTAGGGCAAATGG - Intronic
1092196540 12:6552986-6553008 CCATTCCTATGTTGGGAAAATGG + Intronic
1093183596 12:15994759-15994781 TTCTTAAAATGGTGGGAAATTGG + Intronic
1094008475 12:25781579-25781601 CACTTCACATGTTGGGAAGGAGG - Intergenic
1095246301 12:39926870-39926892 CTCCCAAAGTGTTGGGAAAACGG + Intronic
1096104652 12:48989947-48989969 CTCCCCAAATGTTGGGATTACGG - Intergenic
1096115390 12:49052030-49052052 TTCTTCAAATGGTGGGGACAGGG + Exonic
1096567622 12:52494581-52494603 CCCTCCAAATGTTGGAGAAATGG - Intergenic
1096838282 12:54365329-54365351 CTCCCAAAATGTTGGGATAATGG - Intergenic
1097322255 12:58239157-58239179 CTATTCAAATTTGAGGAAAAGGG + Intergenic
1098725876 12:73966310-73966332 TTCTTCAAATCTTGGGCAAAAGG - Intergenic
1098827838 12:75320339-75320361 CTGTACAGATGTTGGGAAAACGG - Intronic
1099259237 12:80355807-80355829 CTATACAAATGTTTGGAGAATGG + Exonic
1101020859 12:100552663-100552685 CTCCTTAAATGTTGGGATTATGG - Intronic
1101462773 12:104913634-104913656 CACTTCAAAGGAGGGGAAAAAGG - Intronic
1102269114 12:111515935-111515957 CTCTTGAATTGTTGTTAAAAAGG - Intronic
1103280187 12:119751352-119751374 ATGATCAAATGTGGGGAAAATGG + Intronic
1104645010 12:130491004-130491026 ACCTACAAATGGTGGGAAAATGG + Intronic
1105772221 13:23622645-23622667 CACTTAAAAAGTTAGGAAAATGG - Intronic
1106158348 13:27178133-27178155 CTCTTCCCATGCTGGGAAAAAGG - Intergenic
1106536834 13:30652408-30652430 CTATTTAAATATTGGGAAAGGGG + Intronic
1107076495 13:36326346-36326368 CTGTTCTACTATTGGGAAAATGG - Intronic
1109779831 13:67094526-67094548 CTTCTCAAATGTTGGTAATAAGG + Intronic
1110266482 13:73543272-73543294 CTCTTCAACTGAGGAGAAAAAGG - Intergenic
1110291689 13:73815079-73815101 CTCCTCAAATGTTAGGAATTAGG + Intronic
1111163261 13:84422104-84422126 CTCTTCACATGTGGGGATTATGG - Intergenic
1114137848 14:19873153-19873175 CAATTCAGAAGTTGGGAAAAAGG + Intergenic
1115127718 14:30016567-30016589 CTCTTCTCATGTTTGGCAAAAGG + Intronic
1115343727 14:32319530-32319552 ATCTTATAGTGTTGGGAAAAAGG + Intergenic
1115711100 14:36051591-36051613 CTGTTCACATGTGGAGAAAAGGG + Intergenic
1115722100 14:36174129-36174151 CTCTTCAAATGTGGGGAGTTCGG + Intergenic
1115913326 14:38281093-38281115 CTCTGCAAGTGTTGGGTAGAAGG + Intergenic
1116897360 14:50330070-50330092 TCCTTTAAATGTTTGGAAAACGG + Exonic
1117112506 14:52473475-52473497 CATTTCAACTGTAGGGAAAAAGG - Intronic
1117182231 14:53202552-53202574 ATTTTAAAATTTTGGGAAAATGG + Intergenic
1120188963 14:81422650-81422672 TTCTTCAAATGCTGGAAAACTGG - Intronic
1124090837 15:26598673-26598695 CTTTCCAAATGCTTGGAAAATGG - Intronic
1125753604 15:42047227-42047249 CTCTCAAAATGCTGGGATAATGG + Intronic
1128490636 15:68138909-68138931 CTCTTCAAATATTTGAAGAATGG + Intronic
1128772932 15:70295883-70295905 CTCATGAAATGTTGGGATTACGG + Intergenic
1130473284 15:84241935-84241957 CAGTTTAAATGCTGGGAAAAAGG + Intronic
1130480699 15:84355999-84356021 CAGTTTAAATGCTGGGAAAAAGG + Intergenic
1130484897 15:84393426-84393448 CAGTTTAAATGCTGGGAAAAAGG + Intergenic
1130491013 15:84431760-84431782 CAGTTTAAATGCTGGGAAAAAGG - Intergenic
1130502597 15:84510559-84510581 CAGTTTAAATGCTGGGAAAAAGG - Intergenic
1130595570 15:85246530-85246552 CAGTTTAAATGCTGGGAAAAAGG + Intergenic
1131972668 15:97907686-97907708 CTCTTTAAATGGTAGAAAAATGG + Intergenic
1133310033 16:4839348-4839370 CTCTTGAAGTGTTGGGATTACGG + Intronic
1133419146 16:5630773-5630795 GACTTCAATTGTTGGAAAAAAGG + Intergenic
1140864299 16:79046542-79046564 ATCTTCACATGGTGGGAAGAGGG + Intronic
1141103347 16:81213968-81213990 CTCCCCAAATGTTGGGATTACGG - Intergenic
1141288813 16:82698354-82698376 CTCTGTAGATGGTGGGAAAAAGG + Intronic
1142559779 17:803123-803145 CTCTTCACAGGGTGGGAAAGTGG - Intronic
1143903880 17:10195014-10195036 CTCTTCAAAGGATGGGCAGAGGG - Intronic
1145103302 17:20094459-20094481 CTCCTGAAATGTTGGGGAAAAGG + Intronic
1146241635 17:31234290-31234312 ATGTTCAAATGTTTTGAAAATGG + Intronic
1146659490 17:34654913-34654935 CTCTTCAGATCTAGGCAAAAGGG + Intergenic
1149069828 17:52526638-52526660 TTCTTCACATGTTGGCAACAAGG - Intergenic
1149239499 17:54632567-54632589 CTCCTCAAAGTATGGGAAAAGGG - Intergenic
1150364659 17:64571269-64571291 GTCTTGGAATGTTAGGAAAAGGG - Intronic
1151992063 17:77581683-77581705 CTCTTAAAGTGTTGGGATTATGG + Intergenic
1152534916 17:80945034-80945056 CTCCTCAAGTGTTGGGATTATGG - Intronic
1153564806 18:6408984-6409006 GTCTTCAAAGGTAAGGAAAATGG + Intronic
1153947414 18:10030020-10030042 CTCTTCTAATTTTTGGAAAGGGG - Intergenic
1155179663 18:23333487-23333509 CTCTTGAAATGTTAGGTTAAGGG - Intronic
1155402300 18:25452288-25452310 CTCTTCAGATTTTGGAGAAATGG - Intergenic
1155679741 18:28474642-28474664 CATTCCAAATGTTGGGAAATCGG - Intergenic
1155958652 18:31975341-31975363 CTCATCAAAAGTTGGAAAGAAGG - Intergenic
1157069549 18:44390070-44390092 TTCTCCAGATATTGGGAAAAGGG - Intergenic
1157800237 18:50613889-50613911 CTCTACAAATGTTAGAAAAGGGG - Intronic
1158118510 18:54023582-54023604 TTCTTCAAATAATAGGAAAAGGG + Intergenic
1158296677 18:56004101-56004123 CTTTTAAAAAGTTTGGAAAATGG + Intergenic
1158340124 18:56457208-56457230 CTCTCCAATTGATGGGAATATGG - Intergenic
1159533687 18:69687790-69687812 TTCTCCTAAGGTTGGGAAAAAGG + Intronic
1160316845 18:77856198-77856220 ATCTTAAAATGTTGAGAAATAGG + Intergenic
1166541120 19:43606721-43606743 CTCTGTAAGTGCTGGGAAAATGG + Intronic
1167548552 19:50143916-50143938 CTCTTCCAATACTGGGAAAGGGG - Intergenic
926922035 2:17948426-17948448 CTTATCAAATTTTGGGGAAAAGG + Intronic
929421834 2:41798620-41798642 TTCTTCTAAGATTGGGAAAAAGG - Intergenic
929422966 2:41813695-41813717 CACTTCAAATCTACGGAAAATGG - Intergenic
930291584 2:49500381-49500403 CTCTGCACATGTTGTGAAAGTGG + Intergenic
930829978 2:55732693-55732715 CCCTTCAAGTGATGTGAAAACGG - Intergenic
931084974 2:58819881-58819903 CTCATTAAATGCAGGGAAAAAGG + Intergenic
931452804 2:62382548-62382570 CTCTTCTAGTGTTTGGAGAAGGG + Intergenic
932315663 2:70780290-70780312 CTCATCAAGGGTAGGGAAAAGGG + Intronic
933053993 2:77638346-77638368 CTCTTCCACTCTTGGGAGAAGGG - Intergenic
933249025 2:80007807-80007829 CTCCTCCAATGTTGGGAGAAAGG - Intronic
933292283 2:80451354-80451376 TTCTTCACATGGTGGCAAAAAGG - Intronic
933305358 2:80590684-80590706 ATTTTAAAATATTGGGAAAAAGG - Intronic
934099535 2:88640276-88640298 CTTTTTAAATGGAGGGAAAATGG + Intergenic
934537592 2:95148527-95148549 CTCTTCAAATTTAGTGAAACTGG - Exonic
934585562 2:95490508-95490530 CTCATCAAAAGATGGGAAAGAGG + Intergenic
934593905 2:95586251-95586273 CTCATCAAAGGATGGGAAAGAGG - Intergenic
934788874 2:97039433-97039455 CTCATCAAAAGATGGGAAAGAGG + Intergenic
935230871 2:101094701-101094723 CCCTTCAACTGGTGGGAAAGTGG + Intronic
938992448 2:136643435-136643457 CCCATCAGATGATGGGAAAAGGG - Intergenic
939042107 2:137202276-137202298 ATCTTAAAAATTTGGGAAAAGGG + Intronic
939081807 2:137671693-137671715 CTCTTCACATGTGGGGATTATGG + Intronic
940221514 2:151356907-151356929 TTCTTGAAGTGTTGGGAGAAAGG - Intergenic
941252617 2:163185137-163185159 CTTGTCACATGTGGGGAAAAGGG + Intergenic
941853317 2:170206071-170206093 CTCTACTACTGTTGGGACAAAGG - Intronic
942204000 2:173601154-173601176 CTCTTCCAATGTGGAGAAATAGG - Intergenic
942348535 2:175028890-175028912 CTCTCAAAATGTTGGGATTATGG - Intergenic
943587143 2:189754575-189754597 CTCTTCTATTGGTTGGAAAATGG + Intronic
943830683 2:192457750-192457772 CTTTTCTAATTTTTGGAAAAAGG + Intergenic
943989400 2:194668361-194668383 CTCTTCAGATTTTGGGATAGTGG - Intergenic
943999973 2:194821988-194822010 TTCTTGAAATGTTGGTAACACGG + Intergenic
944547074 2:200809705-200809727 CTCTGGAAATGTTGAGAAAGGGG + Intergenic
944549133 2:200829614-200829636 ATCTGCAAAAGTTGGAAAAAGGG + Intergenic
944689900 2:202149384-202149406 CTCTTCAAACGTTAAGATAATGG + Intronic
945053921 2:205851258-205851280 CTCATGGAATGTTGGGAGAATGG - Intergenic
945552393 2:211236300-211236322 GTTTTCACCTGTTGGGAAAAGGG + Intergenic
946142328 2:217702261-217702283 CTCTTTGAATCTTGGGAAAGTGG + Intronic
948364114 2:237443500-237443522 TTCAACAAATGTTGGGAAAGTGG - Intergenic
948811516 2:240480799-240480821 ATCTGGAAATGTTGGGAAAGTGG + Intronic
1169760608 20:9088409-9088431 TTCTTCTAATGATGAGAAAAGGG - Intronic
1170517427 20:17146091-17146113 CTTTTCAAATGTGAAGAAAATGG + Intergenic
1170552470 20:17489591-17489613 TCCTGCAAATGCTGGGAAAATGG + Intergenic
1171003709 20:21441743-21441765 TTCCTCTAATGTTGGGAACACGG + Intergenic
1171313983 20:24169909-24169931 ATCATCAGATGTTAGGAAAATGG - Intergenic
1171467678 20:25342522-25342544 CTGTTGGAATGTTGGAAAAATGG - Intronic
1172386916 20:34540422-34540444 ATCTCCAAATGCTGGGAAAACGG - Intronic
1173079267 20:39850246-39850268 CTCCTCAAAAGCTGAGAAAAAGG - Intergenic
1173085449 20:39911809-39911831 CTTTGCAAATGCTGAGAAAAGGG - Intergenic
1173711664 20:45162679-45162701 CTCACTTAATGTTGGGAAAATGG + Intergenic
1174003639 20:47392949-47392971 CACTGGAACTGTTGGGAAAAGGG + Intergenic
1175349143 20:58306295-58306317 CTGTTCAATTCTTTGGAAAATGG - Intergenic
1176102288 20:63370020-63370042 CTCTTGTAATGTCGGGAAACCGG + Intronic
1177179134 21:17726139-17726161 CTATTCATGTGTTGGGAAACTGG - Intergenic
1177867417 21:26528695-26528717 CACTTAAAATGAGGGGAAAAGGG + Intronic
1178165597 21:29972305-29972327 CTCTCCAGATGATGGGGAAAAGG + Intergenic
1180588641 22:16916426-16916448 CTTTTCCAATCTTGGAAAAAAGG - Intergenic
1183880168 22:40820261-40820283 TTCTGCAAATTTTGTGAAAACGG - Intergenic
1184046420 22:41975296-41975318 CCCTTGAAATGTTGGGAATGAGG - Intergenic
1184175534 22:42786812-42786834 CAGTTCAAATGGTGGGAAGAAGG + Intergenic
1184548268 22:45188732-45188754 CTGTGCAACTGTTGGGAAAAGGG + Intergenic
949849138 3:8404243-8404265 CTCCACAAATGTTTGGAAGATGG - Intergenic
950938462 3:16867626-16867648 GTGTTCTAATGTTGGCAAAATGG + Intronic
951331457 3:21374122-21374144 CTCTACATATGCTTGGAAAATGG + Intergenic
952308236 3:32164155-32164177 CTCTTCCAACCTTGGGGAAAGGG + Intronic
952777158 3:37057622-37057644 CTCTCCAAATGCTGGGATTATGG + Intronic
952977422 3:38708105-38708127 CCCTGCAAATGCTGGGAAACTGG + Intronic
953014408 3:39059192-39059214 CTCTTCAGATCTTAGGAGAAAGG - Intronic
953397523 3:42584832-42584854 CTCTTCAAATATGGGGAATTGGG + Intronic
954831175 3:53422486-53422508 CTCTTCAAATGTTATGAAAGGGG + Intergenic
955373356 3:58372967-58372989 CTGTTGAAATGTTGGGAACTGGG + Intronic
955884527 3:63583736-63583758 CTATTCATATGTTGGAAAATGGG - Intronic
956812973 3:72882159-72882181 CTTTTCAAATTCTGGGACAATGG + Intergenic
957154837 3:76534406-76534428 CTATTCATATGATGGGAAATGGG - Intronic
958844471 3:99249637-99249659 AACTTCACATGTTTGGAAAATGG + Intergenic
959289887 3:104460333-104460355 CTCTTAGAAAGTGGGGAAAATGG - Intergenic
960258546 3:115537584-115537606 CTTTTAAAGTCTTGGGAAAAAGG + Intergenic
961028431 3:123581487-123581509 CTCTCCACATGGTGGGAAACAGG - Intronic
961863329 3:129935479-129935501 CTCCTAAAATGCTGGGAATACGG - Intergenic
962928706 3:140018105-140018127 CTTTTAAAATGTGGAGAAAAGGG - Intronic
963246312 3:143066885-143066907 TTCTTCTAATGTTGGGGAATGGG + Intergenic
964022210 3:152026207-152026229 CTCCTCAAATATTTGAAAAACGG + Intergenic
964094986 3:152920788-152920810 GACTTCAAATGGTGGGAGAATGG + Intergenic
964586142 3:158304691-158304713 ATATTAAAATGTTGGGAGAAAGG - Intronic
964998454 3:162919443-162919465 GTCTTCAAATGATGGGGAAAGGG + Intergenic
967203723 3:187100175-187100197 CCCTTCAAAAAGTGGGAAAAGGG + Intergenic
969320224 4:6407760-6407782 CTATTCAAAAGTGAGGAAAATGG + Intronic
970349486 4:15187269-15187291 TTCTGTAAAGGTTGGGAAAAGGG - Intergenic
970676773 4:18459412-18459434 CCCTTCAAATGTTGGCAGAAGGG + Intergenic
971170951 4:24231947-24231969 CTCTTAAATTGAAGGGAAAATGG - Intergenic
972751410 4:41992497-41992519 CCCTTTAAGTGTTGGCAAAAAGG + Intronic
974968788 4:68800874-68800896 TCATTGAAATGTTGGGAAAATGG + Intergenic
975747726 4:77491410-77491432 CTGTTCAAATGTTGTCAAAGAGG - Intergenic
977200463 4:94108771-94108793 CTCATGCAATGTTGGGAAGATGG + Intergenic
977734437 4:100396367-100396389 CTCATGAAATGTAGAGAAAATGG + Exonic
979008127 4:115330664-115330686 CTGTTTTACTGTTGGGAAAATGG + Intergenic
979812903 4:125062465-125062487 GTTTTCAAATGTTGTTAAAATGG - Intergenic
981278790 4:142933080-142933102 CTCTTCAAATATTGAGAAACTGG + Intergenic
983644459 4:169975984-169976006 CCCTGCAAATGCTGGGAAAGAGG + Intergenic
983961252 4:173757560-173757582 CTCTAGAGTTGTTGGGAAAAAGG - Intergenic
983973970 4:173909878-173909900 CTCTTCAAATGTAAGCTAAAAGG - Intergenic
984620903 4:181950698-181950720 TTTTTCAGATGTTGAGAAAATGG - Intergenic
985123997 4:186672908-186672930 ATTTTCAAATGTTGGGAAAACGG - Intronic
985920676 5:2970341-2970363 CTCTTCAGATGTTCTGAACATGG + Intergenic
986191553 5:5500995-5501017 CTGTTCAAATCTAGGGCAAATGG - Intergenic
987872683 5:23641084-23641106 CTCTTCACATGGTGGCAGAAAGG - Intergenic
988593048 5:32565759-32565781 CTCTACAAGGGTTGGGAAGAGGG + Intronic
989225700 5:39025677-39025699 CTCCTCACATGGTGGGGAAATGG + Intronic
989626116 5:43430953-43430975 CTCCTCAAATTCTGGGGAAATGG - Intergenic
991363643 5:65845989-65846011 CTCCTAAAATGTTGGGATTACGG + Intronic
992582352 5:78192794-78192816 TTCTTCACATGATGGAAAAAAGG - Intronic
992590692 5:78293391-78293413 CTTTTCTAACCTTGGGAAAAAGG + Intronic
996985113 5:129552431-129552453 TTCTTCTAATTTTGAGAAAATGG + Intronic
997281943 5:132654823-132654845 CACTTCACATGTAGGGACAAGGG + Intergenic
997602284 5:135148894-135148916 CTCATTAAATGTTGGGTAACTGG - Intronic
997886132 5:137631401-137631423 TTCTTCACATGTTGGGGAATAGG + Intronic
999893878 5:156007795-156007817 CTATCCAGATGTTGGGAATAAGG + Intronic
1000303810 5:159977818-159977840 CTCTTCAAATGATAGGAGCAGGG + Intergenic
1001865063 5:175096721-175096743 CTCTTGACATGTTAGGAAACTGG - Intergenic
1003428119 6:6011501-6011523 CTCTCAAAAGGTTCGGAAAAAGG + Intergenic
1003701773 6:8473969-8473991 CTCTTCACATGTAGGGATTATGG + Intergenic
1003933927 6:10956190-10956212 GTTTTCAAAGGTTGGGAGAATGG - Exonic
1004564538 6:16783460-16783482 CCATTCAAACTTTGGGAAAAAGG + Intergenic
1005217625 6:23550065-23550087 TTCTTAAAATGTTGGATAAATGG + Intergenic
1005380735 6:25231776-25231798 TACTCCAAATGTTGGGAAACAGG + Intergenic
1005575248 6:27184019-27184041 CTCATCAAAAGTTGGAAAGAGGG + Intergenic
1005851425 6:29825844-29825866 CTCCTCAAATGTTAGGATACAGG - Intergenic
1006591644 6:35162378-35162400 CTATTTAATTGTTGGGAAACGGG - Intergenic
1006652530 6:35563448-35563470 CTCATCAAAGGGTGGAAAAAAGG - Intergenic
1008123419 6:47643618-47643640 CTCATCAAAGGGTGGAAAAAAGG + Intergenic
1008867843 6:56236215-56236237 GTCTTCAAATGCTGGGAACATGG + Intronic
1010722287 6:79296999-79297021 CTCTTCACATGGTGGCAGAAAGG + Intergenic
1010790392 6:80057593-80057615 TTCTTCTCATGTTAGGAAAAGGG - Intergenic
1010908929 6:81528877-81528899 CACTTCAAATGTTGGAGTAATGG + Intronic
1011012889 6:82721950-82721972 CTATTCTAAAGTTGGGATAAGGG - Intergenic
1011177720 6:84583973-84583995 CTCGTCTACTGGTGGGAAAATGG - Intergenic
1011682990 6:89800954-89800976 TTCTGCAAATGTAGAGAAAAAGG + Intronic
1013084255 6:106842050-106842072 CTCTGCAAGTGTGGGGAAGAGGG - Intergenic
1013560286 6:111296762-111296784 CTCATCACATCATGGGAAAAGGG + Intergenic
1014876499 6:126667465-126667487 CCCTTCAAATGAATGGAAAATGG - Intergenic
1015049167 6:128818145-128818167 TTCTTCACATGATGGGAAGAAGG + Intergenic
1015804880 6:137098654-137098676 CTCTTCAACTATTGGGAAATGGG - Intergenic
1016067779 6:139701654-139701676 TTCTTCACATGCTGAGAAAAAGG + Intergenic
1018744789 6:166753869-166753891 CTCTTGAAATTTCGGGAAAGTGG - Intronic
1019847481 7:3520736-3520758 TTCTTTAAATGCTGGTAAAAGGG - Intronic
1021593259 7:22287955-22287977 CTCTTCAACTGGTGGGCAATCGG - Intronic
1021634970 7:22683025-22683047 CTCTTCACATGGTGGGAACTGGG - Intergenic
1022293780 7:29030077-29030099 CTCTTCAAGTGTTGGAATCATGG - Intronic
1024489307 7:49959171-49959193 TTCCTCTAATATTGGGAAAAGGG + Intronic
1024596816 7:50945508-50945530 CTCCCAAAGTGTTGGGAAAAAGG - Intergenic
1024608474 7:51042617-51042639 CTCTCAAAATGTTGGGATTACGG + Intronic
1024819033 7:53305441-53305463 GTCTTCAAAAGTTTGGAAATGGG - Intergenic
1025026323 7:55519207-55519229 CTCTTCCAATGGTGGGGAGAAGG - Intronic
1025254037 7:57371079-57371101 CCATTCAAAACTTGGGAAAAGGG + Intergenic
1026695110 7:72584300-72584322 CTCTTAAAATGCTGGCAATATGG + Intronic
1026882987 7:73919423-73919445 CTCTACAGATGTTGGGGGAAGGG - Intergenic
1028454447 7:91023685-91023707 CTCTCACAATGTTGGGAAACAGG + Intronic
1029340488 7:99939865-99939887 CTCTTTAAATGTTGCCAAGAAGG + Intergenic
1030542286 7:110845882-110845904 ATCCTCACATGGTGGGAAAAGGG - Intronic
1031557172 7:123191859-123191881 TGCTTTAAATGTTGGGAACAGGG - Intronic
1031671170 7:124548382-124548404 CTCTTCAAATGTAAAAAAAAAGG + Intergenic
1031924627 7:127627772-127627794 CTCTTCAAATGCTGGGATTATGG - Intergenic
1032007462 7:128314524-128314546 CTCTTCAAAAGAGGAGAAAAGGG + Intronic
1034051483 7:147988786-147988808 CTCTTCAAATGGTGAGAGATTGG - Intronic
1034783728 7:153905774-153905796 CTCTTGAGATGCTGGGAACAAGG + Intronic
1037108262 8:15136682-15136704 CTCTTCACAGGGTGGCAAAATGG - Intronic
1041755914 8:61313110-61313132 TTCTTATAATGTGGGGAAAATGG + Intronic
1042240421 8:66658392-66658414 TTTTTCAAATGTTGGGTAAAGGG - Intronic
1042652624 8:71060021-71060043 CTCTTCAGATGTGGAGAAACTGG - Intergenic
1043238537 8:77900114-77900136 CTCTTTAAATGATACGAAAAGGG - Intergenic
1043345968 8:79297706-79297728 TTCTTCATATGTTGGGAGCAAGG - Intergenic
1043362473 8:79491437-79491459 CTACCCAAATCTTGGGAAAAGGG - Intergenic
1044385751 8:91586225-91586247 AACTTAAAATGTTGGGAGAAGGG - Intergenic
1044567632 8:93682317-93682339 CTCTTCCAACGTTGTGGAAAGGG + Intergenic
1045250516 8:100479857-100479879 ATAGTAAAATGTTGGGAAAAAGG + Intergenic
1046093227 8:109527849-109527871 CTCTGGAACTGTTGGGAAAGAGG - Intronic
1046975780 8:120275650-120275672 CTCATCAAAAAATGGGAAAATGG + Intronic
1047444804 8:124910129-124910151 CTCTTCAAAGGGTGGAAAGAAGG + Intergenic
1047627822 8:126674826-126674848 GTCTTCAGATGTAGGCAAAATGG - Intergenic
1048748402 8:137642703-137642725 ATCTGCAAATGTTGGGAACAAGG - Intergenic
1049517598 8:143069684-143069706 CACTTCAAATGTGGGGGGAAAGG - Intergenic
1051094171 9:13446245-13446267 CTCTTCAAGTTTTGAAAAAAGGG + Intergenic
1051896196 9:21991602-21991624 TTTTTCATATGTTGGGAAAATGG + Intronic
1052196054 9:25716298-25716320 TTCTGCAAGTGCTGGGAAAATGG + Intergenic
1055391392 9:75825836-75825858 CTAGTCAAAAGTTGGCAAAAGGG - Intergenic
1055982977 9:82024198-82024220 CTCTTCAACTTTTTGCAAAATGG - Intergenic
1057320400 9:94007380-94007402 TTCTTCAAAAGTTGACAAAAAGG + Intergenic
1057722616 9:97545125-97545147 CTCTGCAAATGCAGGGAACAGGG + Intronic
1057734327 9:97640236-97640258 AGCTTCAAAAGATGGGAAAAAGG - Intronic
1058512989 9:105739780-105739802 CTCCTAAAATGTTGGGATTATGG + Intronic
1059248108 9:112865364-112865386 CTCTTCAAGTGCTGGGATTACGG - Intronic
1059666659 9:116452832-116452854 CTTGTCAAAAGTTGGGAACATGG - Intronic
1060370375 9:123064111-123064133 ATCTTCAAAAGTTGAGAAAGTGG - Intronic
1187815347 X:23225525-23225547 CATTTCAAATGCTGGGAACAGGG + Intergenic
1188222241 X:27555408-27555430 CTTTTCAAATGTTGGCACAATGG + Intergenic
1188573184 X:31614102-31614124 CTTTACAAATATTTGGAAAATGG - Intronic
1189347379 X:40252255-40252277 CTCTTTATTTGTTGGGGAAAGGG + Intergenic
1189574258 X:42334304-42334326 TTCTTCCAAGGTTGGGAACAAGG - Intergenic
1190363132 X:49667556-49667578 TTGTTCCAATGTTGGGCAAAGGG + Intergenic
1190942940 X:55060917-55060939 CTGTTCAACTGTTGGGAGTAGGG + Intergenic
1191214593 X:57921629-57921651 CTCTTCCAATAATGGGGAAATGG - Intergenic
1191979135 X:66906389-66906411 CTCTTCACATTTTGGGAATTGGG - Intergenic
1192031867 X:67522601-67522623 CTCCTAAAATGTTGGAAATATGG + Intergenic
1193624164 X:83795464-83795486 CTCTTCCAATTTTATGAAAAAGG - Intergenic
1193923081 X:87453692-87453714 CTCTTAAAATGCTGGGATTAAGG - Intergenic
1193978683 X:88155469-88155491 CTATTAAACTGTTGGAAAAATGG - Intergenic
1195954613 X:110316928-110316950 CTCTTCAAATGTGAGGAAGCCGG + Intronic
1196323921 X:114378728-114378750 CCCTTCAAATTTTGGTAATATGG - Intergenic
1199270973 X:145882264-145882286 ATCCTCACATGGTGGGAAAAGGG - Intergenic
1199328233 X:146527361-146527383 CTCTTCAAATGTGAGGATGATGG - Intergenic
1199730289 X:150625331-150625353 CTCTACACCTGCTGGGAAAACGG - Intronic
1199841077 X:151649735-151649757 CTCTTCAAATATTTGGTAAAGGG + Intronic
1200467503 Y:3537731-3537753 CTTTTCAAATGAGGAGAAAATGG + Intergenic
1201940096 Y:19449892-19449914 CTCTTCAAAGGTTAGAAAGATGG + Intergenic
1202367225 Y:24173827-24173849 CAGTTTAAATGCTGGGAAAAAGG + Intergenic
1202503556 Y:25496296-25496318 CAGTTTAAATGCTGGGAAAAAGG - Intergenic
1202601726 Y:26600530-26600552 CCCTGCCATTGTTGGGAAAAGGG + Intergenic