ID: 1079512694

View in Genome Browser
Species Human (GRCh38)
Location 11:21229537-21229559
Sequence ACTCTTGGTGGAACACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079512688_1079512694 16 Left 1079512688 11:21229498-21229520 CCTGGGCTCTTGGCACTTGTGCG 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1079512694 11:21229537-21229559 ACTCTTGGTGGAACACAGCCAGG 0: 1
1: 0
2: 0
3: 22
4: 184
1079512687_1079512694 24 Left 1079512687 11:21229490-21229512 CCATTCTGCCTGGGCTCTTGGCA 0: 1
1: 0
2: 3
3: 30
4: 358
Right 1079512694 11:21229537-21229559 ACTCTTGGTGGAACACAGCCAGG 0: 1
1: 0
2: 0
3: 22
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079512694 Original CRISPR ACTCTTGGTGGAACACAGCC AGG Intronic
900397774 1:2460246-2460268 GCTCTTGGGGGAACCCGGCCTGG - Intronic
901491044 1:9596460-9596482 AGTTTTATTGGAACACAGCCAGG - Intronic
901500477 1:9649813-9649835 ACTCTTGGTCCACCAAAGCCTGG + Intergenic
902089687 1:13893246-13893268 GCTGGTGCTGGAACACAGCCGGG + Intergenic
905253562 1:36665534-36665556 TCTTTTGGAGGAACACAGGCAGG + Intergenic
909185922 1:72485964-72485986 AGGCTTGGTGGAAAGCAGCCAGG + Intergenic
912392570 1:109314406-109314428 ACACTCGGTGGTACACAGCAGGG + Intronic
912909785 1:113746101-113746123 AATCTAGCTGAAACACAGCCAGG - Intronic
913335548 1:117706424-117706446 ACTCTGGGTGGGACCCAGTCAGG - Intergenic
913969507 1:143403922-143403944 ACTCTTTGTGGGAAAGAGCCTGG + Intergenic
914063884 1:144229521-144229543 ACTCTTTGTGGGAAAGAGCCTGG + Intergenic
914115266 1:144736833-144736855 ACTCTTTGTGGGAAAGAGCCTGG - Intergenic
915661286 1:157407771-157407793 ACTCATTGTGAAAAACAGCCTGG - Intergenic
916063922 1:161120887-161120909 TCTCTTGATGGAACACAGATGGG + Exonic
917430061 1:174957155-174957177 AGTTTTCTTGGAACACAGCCAGG + Intronic
920673784 1:208024772-208024794 CTTCTTGGTGGAGCAAAGCCTGG + Exonic
921320509 1:213934109-213934131 ACTCTGGCTGGGACACATCCTGG - Intergenic
921384332 1:214553371-214553393 ACACTTTCTGGAACACAGTCAGG - Intergenic
921743641 1:218713338-218713360 ACTATGGTTGGAACACAGCAGGG - Intergenic
923922396 1:238582441-238582463 AATCATGGTGAAACACACCCTGG + Intergenic
1063999099 10:11648460-11648482 AGACTTGGTTGATCACAGCCGGG - Intergenic
1065947749 10:30622670-30622692 AGTCTTATTGGAACACAGCCAGG + Intronic
1067081019 10:43212216-43212238 GCTGTTGTTGGAACACATCCCGG + Intronic
1068730323 10:60350896-60350918 ATTCTTCCTGGAACACAGCCAGG - Intronic
1070167511 10:73909855-73909877 ACACTTGGAGGAACATAGCAGGG - Intronic
1070409749 10:76128881-76128903 ACGCTCCTTGGAACACAGCCAGG - Intronic
1071429919 10:85599056-85599078 ATTCCTGGTGGAGCACAGCTTGG - Intergenic
1071454721 10:85837118-85837140 AGCCTTCGTGGCACACAGCCAGG + Intronic
1072125154 10:92439086-92439108 ACTGTTGGTGGAACATAGTTTGG - Intergenic
1075258968 10:120946508-120946530 ACTCTTGGGGCAACCCATCCAGG - Intergenic
1076644007 10:131939039-131939061 AGTGTTAGTGGAACACAGTCAGG - Intronic
1078156011 11:8800678-8800700 TCTCTTGTTGAAATACAGCCTGG - Intronic
1078484375 11:11707980-11708002 AATCTGGATGGAAAACAGCCTGG + Intergenic
1079512694 11:21229537-21229559 ACTCTTGGTGGAACACAGCCAGG + Intronic
1080749514 11:35139311-35139333 AGTTTTGGTGGCACGCAGCCTGG + Exonic
1080956894 11:37108259-37108281 TCTCTTGGAGATACACAGCCTGG + Intergenic
1081744760 11:45465051-45465073 TCACTTGGTGGTTCACAGCCAGG + Intergenic
1083666498 11:64277893-64277915 AGTGTTAGTGGAACACAGCAAGG - Intronic
1086520274 11:87661206-87661228 TCTCCTGGTGGAAAACACCCTGG - Intergenic
1088440612 11:109866601-109866623 ACACTTATTAGAACACAGCCAGG + Intergenic
1092287435 12:7136893-7136915 ACTCTCGGTGCACTACAGCCAGG + Exonic
1094522242 12:31204297-31204319 ACTATTTGAGGAACACAGTCAGG + Intergenic
1095233480 12:39769900-39769922 ACTTTTGTTTGAACACATCCAGG - Intronic
1099496457 12:83352938-83352960 CCTCTAGATAGAACACAGCCTGG - Intergenic
1100597317 12:96082739-96082761 ACTCTTGGAGGAATCCAGCTAGG + Intergenic
1101383785 12:104237559-104237581 ACCCTTGGAGGAACAGGGCCGGG - Intronic
1102062679 12:109945510-109945532 ACCCTTGGTGAAACACCTCCTGG + Intronic
1102788449 12:115623446-115623468 AGTTTTATTGGAACACAGCCTGG + Intergenic
1103571800 12:121849790-121849812 ACTACGGGTGGAAAACAGCCTGG + Exonic
1103753975 12:123188477-123188499 TCTCTTAATGGAACACAGCAAGG - Intronic
1104070944 12:125344879-125344901 ACTCTGGGTGGAAGACAGCATGG + Intronic
1105841257 13:24255282-24255304 CCTCTTGATGGAGCAGAGCCAGG - Intronic
1106141888 13:27018771-27018793 AGTTTTCCTGGAACACAGCCAGG + Intergenic
1106404091 13:29458662-29458684 CCTCTTGGTGAACCACAGGCAGG + Intronic
1107805662 13:44151713-44151735 ACTCTTTCTGGAACACAACCTGG + Intronic
1111671338 13:91333920-91333942 ACTGTTGGTGGAAATCAGGCTGG - Intergenic
1112552040 13:100430487-100430509 ACTCCTGGAGGAACACAGAGAGG - Intronic
1115378883 14:32710893-32710915 AGTTTTGTTGGAACACTGCCAGG + Intronic
1118639847 14:67782159-67782181 ACTCTTGTTGCAACACTGCTAGG + Intronic
1119374565 14:74179264-74179286 AATCTTGGAAGAAGACAGCCTGG - Intronic
1120368352 14:83599834-83599856 ACTCTTTGTGGAAAACAGTTTGG - Intergenic
1121003867 14:90473876-90473898 ACCCTTGGAGGAACAGGGCCAGG - Intergenic
1121435414 14:93915974-93915996 AGTTTTATTGGAACACAGCCAGG - Intergenic
1122138852 14:99650255-99650277 CCTCTTGCTGGAACCCAGCCTGG + Intronic
1124268785 15:28261990-28262012 ACTGGTGTTGGAACACTGCCAGG + Intronic
1126174509 15:45722994-45723016 ACTCATGGTGGAAAACAGAAGGG - Intergenic
1127277576 15:57460888-57460910 ACTCTGGGTGGAAGAAGGCCTGG + Intronic
1128695113 15:69755911-69755933 GCTCTTGGTGAGACTCAGCCAGG + Intergenic
1133155762 16:3874482-3874504 AGTTTTACTGGAACACAGCCAGG + Intronic
1133610690 16:7430684-7430706 ACTCTTGATGAAACACAGAATGG - Intronic
1133974766 16:10592773-10592795 AGTTTTATTGGAACACAGCCAGG - Intergenic
1135151148 16:20007131-20007153 AGTTTTATTGGAACACAGCCAGG + Intergenic
1135600645 16:23780507-23780529 AGTTTTATTGGAACACAGCCAGG - Intergenic
1135754097 16:25082071-25082093 AGTTTTATTGGAACACAGCCAGG - Intergenic
1136055637 16:27687350-27687372 CCTCTTGCTGGAACACAACTAGG - Intronic
1138401701 16:56750661-56750683 AGTTTTATTGGAACACAGCCAGG + Intronic
1139974209 16:70795985-70796007 ACTCTTCTGGGAAGACAGCCTGG + Intronic
1140880159 16:79190737-79190759 AGTTTTATTGGAACACAGCCAGG + Intronic
1143405889 17:6677023-6677045 ACTGTTTGTGGAACCCAGCAGGG + Intergenic
1146004181 17:29150409-29150431 AGTTGTGGTGGCACACAGCCAGG + Intronic
1146527891 17:33582399-33582421 CCTCTCGGTTGAACACATCCTGG - Intronic
1147838581 17:43353718-43353740 ACTCTTGTTACAACCCAGCCAGG - Intergenic
1149484022 17:57027933-57027955 GCCCTTGGAGGAACACAGCCAGG + Intergenic
1150194590 17:63282678-63282700 ATTCTTGTTGGTACACAGCGTGG + Intronic
1151785222 17:76272030-76272052 AGTCTTGCTGGAACACAGGCAGG + Intergenic
1152044238 17:77925300-77925322 ATTCTTGCTGGAACACAACCTGG - Intergenic
1152673195 17:81621671-81621693 AGTGTTATTGGAACACAGCCAGG - Intronic
1153166111 18:2263627-2263649 TGACTTGGTGCAACACAGCCGGG - Intergenic
1153432241 18:5030285-5030307 ACTCTTGGGGAGACACAGCATGG - Intergenic
1157984410 18:52420784-52420806 ACCCTTGGAGGAAGTCAGCCTGG + Intronic
1159445369 18:68535756-68535778 AGTCTTGGGACAACACAGCCAGG + Intergenic
1159445596 18:68538084-68538106 AGTCTTGGGACAACACAGCCAGG + Intergenic
1159445794 18:68540262-68540284 AGTCTTGGGACAACACAGCCAGG + Intergenic
1160733366 19:651123-651145 GCTCCTGGTGGAACAGAGCCTGG - Intronic
1160733379 19:651166-651188 ATTCCTGGTGGAACAGAGCCTGG - Intronic
1160733393 19:651209-651231 ACTCCTGGTGGAACGGAGCCTGG - Intronic
1160733408 19:651252-651274 ACTCCTGGTGGAACGGAGCCTGG - Intronic
1161678012 19:5663907-5663929 ACTCTTGGTGAAAGTCATCCTGG + Intronic
1162878339 19:13637794-13637816 ACTGTTGGTGGATGACAGTCTGG - Intergenic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1167687151 19:50963455-50963477 AGTCAGGGTGGATCACAGCCCGG + Exonic
1168352065 19:55681532-55681554 AGTTTTATTGGAACACAGCCAGG + Intronic
925642434 2:5998921-5998943 ACTCTTGGAGGAAGTCAGGCAGG - Intergenic
926570476 2:14524210-14524232 ACTCTTGTTTGATCACATCCAGG - Intergenic
927037411 2:19193462-19193484 ATTCTTCCTGGAACACAGTCTGG - Intergenic
931824467 2:65985581-65985603 ACTTTTACCGGAACACAGCCAGG - Intergenic
932858962 2:75268292-75268314 AGTTTTGTTGGAACACAGCCAGG + Intergenic
933976872 2:87519001-87519023 ACTCTGGATGGGACACAGCTGGG - Intergenic
934174198 2:89564837-89564859 ACTCTTTGTGGGAAAGAGCCTGG + Intergenic
934284514 2:91639186-91639208 ACTCTTTGTGGGAAAGAGCCTGG + Intergenic
934756313 2:96827196-96827218 ACGCCTGGTGCACCACAGCCAGG + Intronic
936316945 2:111431803-111431825 ACTCTGGATGGGACACAGCTGGG + Intergenic
937344028 2:121112020-121112042 ATTCTTGGTGGAATACAGAATGG + Intergenic
937431535 2:121842822-121842844 CCTCTAGAAGGAACACAGCCTGG + Intergenic
937671960 2:124547600-124547622 ACTCTTGGAGGACCACACCATGG - Intronic
937902710 2:127034169-127034191 ACTGTTGCTGGACCATAGCCCGG - Intergenic
944281737 2:197905668-197905690 ACTGTTGGTGGAAGACAGTATGG - Intronic
946005494 2:216521129-216521151 AGCATTGGTGGAACACACCCAGG + Intronic
946495374 2:220191212-220191234 CCTATTGGTGGAAACCAGCCTGG + Intergenic
948783766 2:240340449-240340471 TGTCTTGGTGGCATACAGCCTGG + Intergenic
1170346763 20:15395601-15395623 AGTTTTATTGGAACACAGCCAGG - Intronic
1171206099 20:23282709-23282731 AGTCCTGGTGGGACCCAGCCCGG - Intergenic
1173408357 20:42786999-42787021 AGTTTTGTTGGAACACAGCTGGG + Intronic
1173666786 20:44768615-44768637 AGTGTTGGTGGATCCCAGCCAGG - Intronic
1174005996 20:47411267-47411289 CCTCTCGCTGGAACACAGACTGG + Intergenic
1175895034 20:62332419-62332441 AGTCCAGGTGGAAGACAGCCAGG + Exonic
1178577214 21:33805543-33805565 AGTTTTATTGGAACACAGCCAGG + Intronic
1179110821 21:38443512-38443534 TCAGTTGGTGGAACACAGCCTGG - Intronic
1179984045 21:44911516-44911538 TCTCTTCCTGGCACACAGCCTGG - Intronic
1180845332 22:18978191-18978213 CCTCTTTCTGGAAGACAGCCAGG + Intergenic
1181784998 22:25220654-25220676 ACCCCTGGGGAAACACAGCCTGG + Intronic
1184494099 22:44827252-44827274 CCTCCAGGTGGAACACAGTCAGG + Intronic
1184887576 22:47355756-47355778 ACTGTTTGAGGAACTCAGCCTGG - Intergenic
949295033 3:2511430-2511452 ATCCTTTGGGGAACACAGCCAGG + Intronic
950481300 3:13245896-13245918 ACCCTTTGTGGCACACTGCCGGG + Intergenic
950863771 3:16173001-16173023 ACTCTTGGTTGCAGACAGCATGG + Intergenic
953737228 3:45506249-45506271 ACTCTTGTTGGATCACATCAGGG + Intronic
955574928 3:60350628-60350650 ACTGTTGGTGGAATACAGGGAGG - Intronic
955741407 3:62094856-62094878 CCTCTTGGCAGAACACAGCCAGG - Intronic
960192103 3:114719115-114719137 GCTTTAGGAGGAACACAGCCAGG + Intronic
962077040 3:132093183-132093205 AGTTTTATTGGAACACAGCCAGG - Intronic
962448837 3:135494423-135494445 ACATTTTGGGGAACACAGCCTGG + Intergenic
966317259 3:178661562-178661584 AGTTTTACTGGAACACAGCCAGG - Intronic
967198095 3:187046879-187046901 AGTTTTGTTGGAACATAGCCAGG - Intronic
968981437 4:3852077-3852099 GCCCTTGCTGGAACCCAGCCCGG - Intergenic
969828051 4:9773783-9773805 ACTCTTTGTGGGAAAGAGCCTGG + Intronic
971944457 4:33255632-33255654 TCTGTTGCTGTAACACAGCCTGG - Intergenic
972629296 4:40829451-40829473 ACACATGGTGAAACACAGCAAGG + Intronic
973027202 4:45287550-45287572 AATCTTTGTGGAAAACAGCACGG - Intergenic
975442109 4:74422673-74422695 ACTCTTGGAGGAAAACAGTCTGG - Intergenic
976848576 4:89518206-89518228 ACTCATGGTGCAACTCAGCTGGG - Intergenic
985620272 5:951358-951380 AATCATTGTGGAGCACAGCCAGG - Intergenic
986972147 5:13349382-13349404 TCTCCTGGAGCAACACAGCCTGG - Intergenic
987077505 5:14397890-14397912 AAACTAGCTGGAACACAGCCTGG - Intronic
987900391 5:24003415-24003437 ACTCTGTGTGGAAAACAGACTGG + Intronic
988243129 5:28639550-28639572 ATTCTTGTTGGAAACCAGCCAGG + Intergenic
988739332 5:34054515-34054537 AGTTTTGTTGGAACACAGCCCGG - Intronic
988942482 5:36160151-36160173 AGACTTGGGGCAACACAGCCAGG + Intronic
990425247 5:55681862-55681884 ATTTTTACTGGAACACAGCCAGG + Intronic
990954691 5:61331125-61331147 GCTCGGGGTGGAACGCAGCCCGG - Intergenic
994718751 5:103355550-103355572 ACTCTAGTTGGATCACAGCTGGG - Intergenic
1000045048 5:157515577-157515599 AATTTTACTGGAACACAGCCAGG - Intronic
1001650321 5:173311255-173311277 ACTCCTGGTGGAACTCAGCTCGG + Intergenic
1002614417 5:180442004-180442026 ACACCTGGTGGAAACCAGCCGGG + Intergenic
1003048067 6:2753296-2753318 ACTCTTAGTGTAATCCAGCCGGG - Intergenic
1003393755 6:5735617-5735639 ATTCTTGGGAGAAAACAGCCAGG - Intronic
1004057203 6:12151795-12151817 AGTTTTATTGGAACACAGCCAGG - Intronic
1005080361 6:21951053-21951075 AGTTTTGTTGGAACACAGCCAGG + Intergenic
1005151412 6:22755965-22755987 AGTTTTATTGGAACACAGCCAGG + Intergenic
1006880921 6:37339046-37339068 AGTTTTACTGGAACACAGCCTGG + Intergenic
1010733805 6:79418999-79419021 ACTCATGGTGAAAGACAGACAGG - Intergenic
1011206276 6:84902693-84902715 CCTCTTTTTGGATCACAGCCTGG + Intergenic
1012096184 6:94965144-94965166 ACTGTTGGTGGAAGACAGTATGG - Intergenic
1012644147 6:101658625-101658647 ACTGTTGGTGGAAGACAGAGTGG - Intronic
1013655083 6:112238138-112238160 ACTCCTGGTGGAACATTCCCAGG - Intronic
1014180812 6:118382317-118382339 AGTTTTATTGGAACACAGCCAGG - Intergenic
1016090259 6:139969309-139969331 AATTTTGGGGGAACACAGCAAGG + Intergenic
1019146811 6:169980925-169980947 TCTGTTGGTGGAACAGAGGCTGG + Intergenic
1021504540 7:21367287-21367309 AGTTTTATTGGAACACAGCCAGG - Intergenic
1021695885 7:23276077-23276099 ATTTTTGCTGGAACACAGCCAGG - Intergenic
1023404635 7:39819904-39819926 ACTCTTGGTGAAATACAGTTGGG + Intergenic
1023630703 7:42161292-42161314 TGTTTTGTTGGAACACAGCCAGG + Intronic
1023702315 7:42904966-42904988 ACTCTATGTGGGACACAGTCTGG + Intergenic
1030197185 7:106863811-106863833 ACTCTGGGTAAAACACAGCTTGG + Intergenic
1030779612 7:113583874-113583896 ACTCCTGCTGCAAGACAGCCAGG + Intergenic
1041027793 8:53704346-53704368 ACTCTTGGTGGAAGGCAAACAGG - Intergenic
1041703261 8:60815717-60815739 AATCCTGGAGGAACACAGTCTGG + Intronic
1042486268 8:69349501-69349523 AGTTTTTCTGGAACACAGCCAGG + Intergenic
1044338619 8:91020060-91020082 ACTCTTTCTAGAACAAAGCCTGG + Intronic
1044821847 8:96160567-96160589 GCCCTTGGTGGAACCCAGCTCGG + Exonic
1047554046 8:125909591-125909613 AATCTTGATGGAACAGAGCTAGG - Intergenic
1049149469 8:141025306-141025328 CCTCTGGAAGGAACACAGCCCGG - Intergenic
1049433980 8:142577794-142577816 CCAGCTGGTGGAACACAGCCAGG - Intergenic
1050334038 9:4573778-4573800 ACACTTGGTGGAGCACAGGATGG - Intronic
1054725868 9:68649468-68649490 CATCTTGGTGGGACACAGCTGGG - Intergenic
1058993695 9:110278960-110278982 ACACTTGGTGGAAGACTGCCTGG + Intergenic
1060564130 9:124574599-124574621 ACTCTTGGTGGAAAACGGGAGGG - Intronic
1061385026 9:130284707-130284729 CCTATTGGTGGGACACAGACTGG - Intronic
1061634742 9:131900313-131900335 TCTCTTCGTGGAATACAGCTTGG - Intronic
1186127532 X:6430280-6430302 AGTTTTACTGGAACACAGCCAGG - Intergenic
1186498281 X:10030066-10030088 AGTTTTATTGGAACACAGCCAGG - Intronic
1187725338 X:22196473-22196495 AGTTTTACTGGAACACAGCCAGG - Intronic
1187974819 X:24694172-24694194 GCTCTTGGAGGACCAGAGCCTGG + Intronic
1194977209 X:100408009-100408031 ACTCGTGGTGGAAAAGAGCCTGG - Exonic
1196865830 X:120069933-120069955 AGTCATGGTGGAAGACAGACTGG - Intergenic
1196877266 X:120166347-120166369 AGTCATGGTGGAAGACAGACTGG + Intergenic
1200071747 X:153532583-153532605 CCTCGTGGTGGGAGACAGCCAGG - Intronic