ID: 1079513597

View in Genome Browser
Species Human (GRCh38)
Location 11:21240108-21240130
Sequence ACTTCAGGAGGGAATGGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079513597_1079513603 -1 Left 1079513597 11:21240108-21240130 CCTCTACCATTCCCTCCTGAAGT 0: 1
1: 0
2: 0
3: 21
4: 211
Right 1079513603 11:21240130-21240152 TCTGGAGAAGATAAATGATAAGG 0: 1
1: 1
2: 0
3: 28
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079513597 Original CRISPR ACTTCAGGAGGGAATGGTAG AGG (reversed) Intronic
900376850 1:2358890-2358912 ACTTCTGCAGGGCATGGGAGAGG - Intronic
900967548 1:5969374-5969396 ACCACATGAGGGCATGGTAGAGG - Intronic
901628542 1:10637273-10637295 AGTTCAGGAGGCTCTGGTAGGGG + Exonic
904239615 1:29135233-29135255 ACCTCAGGAGGCAGTGGCAGTGG + Intergenic
905029379 1:34871359-34871381 ACTTAAGGAGGGAATGGACAAGG - Intronic
905066088 1:35184499-35184521 ACTCCAGCAGGATATGGTAGAGG - Exonic
905198250 1:36298294-36298316 TCCTCAGCAGGGAATGGAAGTGG + Intronic
908628135 1:66070394-66070416 AGTATATGAGGGAATGGTAGAGG + Intronic
908985604 1:70016198-70016220 ACTTCTGGAGGGATTTTTAGGGG + Intronic
909862655 1:80628764-80628786 ACTTCAGGAGTAAACTGTAGGGG + Intergenic
911361931 1:96887298-96887320 ATTTCAGGACGGAAAGGCAGCGG + Intergenic
913044628 1:115063068-115063090 ATTTCATGAGGGAATGGATGTGG + Intronic
913164265 1:116170419-116170441 ACTTCTGGAGGGGATGGGACAGG - Intergenic
914198238 1:145461671-145461693 ACTTCAGGGAGGAAGGGCAGGGG - Intergenic
914320574 1:146555547-146555569 ACTGGAGGTGGGAAGGGTAGTGG + Intergenic
914477341 1:148034800-148034822 ACTTCAGGGAGGAAGGGCAGGGG - Intergenic
914510882 1:148330831-148330853 ACTTCAGGAAAGAAGGGCAGGGG - Intergenic
915319102 1:155046452-155046474 ACTGCAGGAAGGAGTGGTGGCGG - Exonic
916379089 1:164188710-164188732 ACAGGAGGAGGGAATGGGAGGGG - Intergenic
919732805 1:200924582-200924604 ACTTCAGGAGGGCGAGGTAGGGG + Intergenic
919757184 1:201073520-201073542 ACCTCAGGTGGGGATGTTAGAGG - Intronic
920815617 1:209329032-209329054 ACTTCAGGGGAGAATGGCAAAGG - Intergenic
921774320 1:219079556-219079578 AATTAAGGAGGGAAAGGAAGAGG - Intergenic
1063051761 10:2457266-2457288 ATTTCAAGAGGGAGTGATAGAGG - Intergenic
1063871384 10:10421268-10421290 ACTTCAGCAGGGAGAGGAAGTGG + Intergenic
1065213744 10:23430083-23430105 ACTTCAGGAGGCAAAGGCAGAGG - Intergenic
1065458890 10:25934800-25934822 ACTTGAGGAGGGAACGGGAGGGG + Intronic
1068109736 10:52665777-52665799 GCTTCAGCAGGCAATGATAGAGG - Intergenic
1068173565 10:53426668-53426690 ACTTCAGGAGGTGAAGGTGGTGG - Intergenic
1071167012 10:82818351-82818373 ACTTCAGGAGGCTGTGGAAGAGG + Intronic
1072006356 10:91253328-91253350 ACTTGAAGGTGGAATGGTAGGGG - Intronic
1072860408 10:98998057-98998079 ACTTCAGGAAGGAATGTTTTGGG - Intronic
1075121320 10:119666902-119666924 ACTTCTGGAGGAGATGGTAGTGG - Intronic
1077288931 11:1779992-1780014 CCTCCAGGAGCGAATAGTAGGGG + Intergenic
1077328786 11:1974939-1974961 ACTCCAGGAGGGACTGGCTGAGG - Intronic
1077468166 11:2743539-2743561 ACTTGAGCAGGGAAGGGAAGGGG + Intronic
1077621361 11:3727615-3727637 ACTTCAGGAGGCCAAGGTGGGGG + Intronic
1078953703 11:16165516-16165538 ACTTCAGAAAGGAATAGTAAGGG - Intronic
1079513597 11:21240108-21240130 ACTTCAGGAGGGAATGGTAGAGG - Intronic
1080117531 11:28637572-28637594 ACTTCAGGAGGGTAGGAGAGAGG - Intergenic
1081386115 11:42475739-42475761 ACTTAAGGAGGTGTTGGTAGTGG - Intergenic
1081897356 11:46597992-46598014 ACTTGATGATGGAATGGTAAAGG + Intergenic
1083989917 11:66240587-66240609 TCTTCTGGAGGGAACAGTAGAGG + Intronic
1084134300 11:67164559-67164581 GCTTTAGGAGGCCATGGTAGAGG - Intronic
1085199751 11:74694740-74694762 TCTTGAGGAGGGACAGGTAGAGG + Intergenic
1085336298 11:75699179-75699201 ACATCTGGAGGGAATGGGAGGGG + Intergenic
1085496599 11:76976030-76976052 AAATCAGCAGGGCATGGTAGTGG - Intronic
1085745627 11:79111994-79112016 ACTGCAGGAGGGCAAGGTGGGGG + Intronic
1086120969 11:83304187-83304209 ACTGCAGGAGGGAAAGGTCATGG - Intergenic
1087613975 11:100467417-100467439 ACTTTAGGAGGCTAAGGTAGGGG + Intergenic
1091256165 11:134187946-134187968 CCTATAGGAGGGAATGGTAGAGG - Intronic
1202811765 11_KI270721v1_random:30118-30140 ACTCCAGGAGGGACTGGCTGAGG - Intergenic
1093992225 12:25603017-25603039 AGTTCAGGAAGAAATGGTAGAGG + Intronic
1096118671 12:49071706-49071728 ACTTGTGGAAGGATTGGTAGAGG + Intergenic
1100448616 12:94684095-94684117 GCTTCAGAAGGGAAGGGTAGAGG + Intergenic
1102460675 12:113097747-113097769 ACTTCAGGAGCGAAAGGAGGAGG + Exonic
1102900150 12:116630364-116630386 ACTTCAGGAGGCCAAGGCAGAGG + Intergenic
1104243512 12:127014765-127014787 ACATTAGCAGGGAGTGGTAGCGG + Intergenic
1109377052 13:61509829-61509851 ACTTTAGGAGGCTAAGGTAGGGG + Intergenic
1110063077 13:71066403-71066425 ACTTTGGGAGGTAATGGTGGGGG + Intergenic
1110844587 13:80179825-80179847 ACTTCAGGGGAGAATGGTGGAGG - Intergenic
1112092249 13:96093692-96093714 ACTGTAGGAGGGAATAGTTGTGG + Intronic
1112274565 13:98004528-98004550 ACTGCAGGAAGGAAGGGCAGGGG - Intronic
1112297080 13:98197587-98197609 ACTTCAGCAGAAAATGGTAGAGG + Intronic
1115322638 14:32100440-32100462 ACTTTAGGAGGCCAAGGTAGAGG - Intronic
1115472489 14:33782946-33782968 CCTTCAGGAGGGAAGTGTAGGGG - Intronic
1117951066 14:61083080-61083102 AGAGCAGGAGGAAATGGTAGAGG - Intronic
1118683031 14:68262726-68262748 GCTTCAGGAGAGAAGGGCAGGGG - Intronic
1120161279 14:81147635-81147657 ACTTCAGGTGGGGGTGGTGGGGG - Intergenic
1120560208 14:85982681-85982703 ACATAAGGAAGTAATGGTAGTGG - Intergenic
1120573720 14:86154049-86154071 ACGTCAGGGGGCAAAGGTAGAGG + Intergenic
1121125077 14:91400562-91400584 ACTGCCTGAGGGAATCGTAGTGG - Intronic
1121800613 14:96771014-96771036 TCTCCAGGTGGGAATGGGAGAGG + Intergenic
1121877217 14:97464307-97464329 CCTTCAGGAGGGAATGGGGCAGG + Intergenic
1122198474 14:100107530-100107552 CTTTCATGAGGGAATGCTAGTGG - Intronic
1122377779 14:101277785-101277807 ACTTCAGTAGGGATGGGGAGGGG - Intergenic
1124361429 15:29039296-29039318 TCTGCAGCAGGGAGTGGTAGAGG + Intronic
1127320294 15:57838349-57838371 ACTTAAGTAGTGAAGGGTAGTGG + Intergenic
1128622677 15:69163665-69163687 TCTTCAGGAGGGAGTTGCAGAGG + Intronic
1128962900 15:72026738-72026760 AATTCAGGAGTGAATGAAAGCGG + Intronic
1132292268 15:100712087-100712109 ACTTCAGGGAGGAATGGAAGGGG - Intergenic
1133701290 16:8311610-8311632 ACTTCTTGAGGCAATGGCAGTGG - Intergenic
1134799294 16:17069859-17069881 CCTTCCTGAGGGACTGGTAGTGG - Intergenic
1135102246 16:19616107-19616129 GCTGCAGGTGGGAATGGAAGTGG + Exonic
1135191051 16:20355040-20355062 TCTGCAGGAAGGAATGGGAGAGG - Intronic
1137585799 16:49663617-49663639 GCTTCAGGAGGGCACGGGAGAGG + Intronic
1137854331 16:51778719-51778741 AATTCAGGAGGGCATGGTCATGG + Intergenic
1137864564 16:51879899-51879921 CCCTCAGGAAGGATTGGTAGAGG - Intergenic
1138132131 16:54489344-54489366 ACTGCAGCAGGGAATGGTCGAGG - Intergenic
1140012959 16:71154559-71154581 ACTGGAGGTGGGAAGGGTAGTGG - Intronic
1140481166 16:75263645-75263667 GCTTCAGAAGGGGATGGGAGGGG - Intronic
1140901779 16:79374432-79374454 AATTCAGGAGAGAAATGTAGGGG - Intergenic
1141825504 16:86476861-86476883 AGTCCAGGAGGGCATGGTTGAGG + Intergenic
1142165566 16:88585702-88585724 AGTTGAGGAGGGAATGAGAGAGG + Intronic
1143229672 17:5342391-5342413 ACTTTAGGAGGCCAAGGTAGGGG + Intronic
1143734867 17:8904540-8904562 ACTCGAGGAGGGATTGTTAGGGG - Intronic
1143783719 17:9242204-9242226 ACTCCAGGAGAGACTGGCAGAGG + Exonic
1145278677 17:21453141-21453163 GCTTCGGGAGGGACTGGGAGGGG + Intergenic
1146180280 17:30693769-30693791 CCTCCAGGAGGGATGGGTAGGGG + Intergenic
1149899900 17:60465622-60465644 ACTTCAGGAGGCCAAGGTAGAGG + Intronic
1149899956 17:60466075-60466097 ACTTTAGGAGGCCAAGGTAGAGG - Intronic
1151206628 17:72512881-72512903 ACTTCAGGAGGGAAATCCAGGGG + Intergenic
1151675581 17:75595755-75595777 ACGTCAGGAGGAAAGGGAAGAGG + Intergenic
1151732212 17:75918127-75918149 ACGTCAGGCGGGCATGGTTGGGG + Intronic
1153998973 18:10467460-10467482 ACTTCAGGAGTGAATATCAGAGG + Intronic
1154208114 18:12354968-12354990 ACTTTAGGAGGGCAAGGCAGGGG + Intronic
1155296187 18:24386591-24386613 ACTTTAGAAAGGAATGGCAGGGG + Intronic
1155517196 18:26635982-26636004 ACTGCAGGAGGGTGTGGGAGGGG + Intronic
1156474191 18:37395279-37395301 AGTGCAGGAGGAAATGGTGGGGG - Intronic
1156648466 18:39196380-39196402 ACAACAGGATGGAATGGAAGAGG + Intergenic
1156833965 18:41530174-41530196 ATTTGAGGAAGGAATGGGAGAGG - Intergenic
1156944212 18:42807867-42807889 ACTTCAGCAGGTAATGGTGTAGG + Intronic
1157255749 18:46137524-46137546 CCTTGAGGAGGGAAATGTAGTGG - Intergenic
1158745481 18:60195402-60195424 GCCTCAGGAGGGGATGGGAGTGG + Intergenic
1160012393 18:75116062-75116084 ACTTCAGGCAGGCATGGAAGAGG - Intergenic
1161115135 19:2492639-2492661 ACCTCAGGAGGGGATGGCTGGGG - Intergenic
1161119618 19:2518201-2518223 ACCTCAGGCGGGACTGGGAGTGG + Intronic
1162978320 19:14221771-14221793 CCTCCAGGAGGGATGGGTAGGGG - Intergenic
1164451330 19:28367945-28367967 GATTCAGGAGAGAATGGGAGTGG - Intergenic
1165295226 19:34921303-34921325 ACTCCAGTAGGGAATGGAGGGGG - Intergenic
1166884717 19:45953254-45953276 TCTCCAGGAAGGAATGGAAGGGG - Intronic
925495103 2:4438980-4439002 ACTTCAGGAGGGAATCCCACAGG + Intergenic
925540543 2:4961764-4961786 ACTTCAGGAGGGTTTCTTAGAGG + Intergenic
926148244 2:10410031-10410053 ACTTCAGGAGGCCAAGGCAGTGG - Intronic
927282072 2:21317763-21317785 ACTTTAGGAGGGAGAGGTACTGG + Intergenic
929562230 2:42963074-42963096 ACCTCAGGAGAGACTGGTTGGGG - Intergenic
931009213 2:57888706-57888728 ACTGCAGGAAGTCATGGTAGAGG + Intergenic
936032519 2:109083751-109083773 ACTGCAGGTGGGAATGTAAGAGG - Intergenic
938072354 2:128315407-128315429 ACCGCAGCAGGGAATGGGAGGGG + Intronic
939893020 2:147759885-147759907 GCTACAGGAGGGAATGATAAAGG - Intergenic
941841001 2:170084511-170084533 GCTTCAGGATGGAGAGGTAGGGG - Intergenic
942133186 2:172900481-172900503 ACTTCAGGAGGCTGAGGTAGGGG - Intronic
945216192 2:207436579-207436601 CCTCTAGTAGGGAATGGTAGGGG + Intergenic
946157112 2:217814258-217814280 ACTTCAGGAGGCCAAGGCAGGGG - Intronic
1171756902 20:29119063-29119085 ACTTCAGGAGGCATAGGAAGAGG - Intergenic
1171785365 20:29458855-29458877 ACTTCAGGAGGCATGGGAAGAGG + Intergenic
1172109948 20:32538739-32538761 GCTCCAGGAGGGAATGGGGGAGG + Intronic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1174391019 20:50218337-50218359 ACTTTAGGAGGCAATAATAGTGG - Intergenic
1174757459 20:53174039-53174061 AATTCAGGAGGGAGAGGAAGGGG + Intronic
1175368655 20:58471938-58471960 ACTTCAGGAGGCCTTGGGAGGGG + Intronic
1175590783 20:60190267-60190289 ACTTCAGGGGAGAAGGGAAGAGG - Intergenic
1179629735 21:42668990-42669012 ACTTCAGGAGGGGATGGTGAAGG - Intronic
1184259017 22:43303991-43304013 ACTGCACGAGGGCATGGAAGAGG - Intronic
951669445 3:25163839-25163861 ACCTTAGGAGGTAAAGGTAGTGG + Intergenic
953165470 3:40460950-40460972 ACTTCAGGAGGCCAAGGTGGAGG + Intronic
953325064 3:42006130-42006152 ACTTTGGGAGGCAAAGGTAGAGG + Intergenic
953516605 3:43599078-43599100 ACTGCAGAAGGGAATGGAATGGG - Intronic
953551638 3:43907981-43908003 GCCTAAAGAGGGAATGGTAGAGG - Intergenic
954101638 3:48377744-48377766 ACTTCAGGAGGGCTTAGAAGTGG + Intronic
955412586 3:58665381-58665403 CCTTCAGGAGTGAAGGGCAGGGG - Intronic
960397158 3:117151583-117151605 ACTTCAGGGAAGAAGGGTAGGGG + Intergenic
962716565 3:138131178-138131200 ACTTCAGGGTGAACTGGTAGAGG + Exonic
965554586 3:170005918-170005940 ACTTCAGGAGGCTAAGGCAGAGG + Intergenic
966141785 3:176765945-176765967 AATTCAGGAAGGAATGGGTGGGG + Intergenic
969345535 4:6567584-6567606 CCATCAGGAGGGTAGGGTAGGGG - Intergenic
973686622 4:53377131-53377153 ACCTCCGGAGAGAAGGGTAGGGG + Intergenic
973897545 4:55429842-55429864 ACTTGAGGAGGGAAGTGCAGGGG + Exonic
976545174 4:86327217-86327239 ACTTTGGGAGGGTAAGGTAGGGG - Intronic
977237508 4:94526657-94526679 ACTTAAGGAGAGAATGGTCCTGG - Intronic
980170528 4:129284058-129284080 ACTTCATGAGGAAATACTAGGGG + Intergenic
980439960 4:132829516-132829538 AATTCAGGCAAGAATGGTAGTGG - Intergenic
981105027 4:140870892-140870914 ATTTCAGGAGAGACTGGGAGTGG + Intronic
982235717 4:153249423-153249445 ACCGCAGGATGGAATCGTAGAGG + Intronic
984675252 4:182540171-182540193 ACTTATGGAGGAAATGCTAGAGG - Intronic
985175253 4:187193558-187193580 GCTTCAGGAGGGCATGGAAAAGG + Intergenic
985370492 4:189280882-189280904 ACTTCAGGAGGCACAGGAAGAGG + Intergenic
987204754 5:15613623-15613645 ACTTGAGGAGGGAATGGCTCAGG - Intronic
988079626 5:26399946-26399968 ACTTTAAGGGGTAATGGTAGTGG + Intergenic
988129333 5:27081888-27081910 ACTTGAGGAGGGAGTGTGAGAGG + Intronic
990332001 5:54737151-54737173 ACCTCTGGAGAGAAAGGTAGAGG - Intergenic
995439332 5:112172816-112172838 ATTTCAGGAAGGTATGATAGTGG + Intronic
995775653 5:115722480-115722502 ACTTCAGGAGGCTAAGGTGGTGG + Intergenic
997922288 5:137993381-137993403 ACTTCAGGAGGCCAGGGCAGAGG + Intronic
998687457 5:144545347-144545369 ACTTACCGAGGGAATGTTAGTGG + Intergenic
999143891 5:149380170-149380192 ATTTCAGGAGGGAATGGGCCAGG - Intronic
999258546 5:150223217-150223239 ACTGGAGGAGGGGATGGGAGGGG + Exonic
999409192 5:151335546-151335568 ACCTGAGGAAGGAATGGGAGAGG + Exonic
1003579044 6:7322755-7322777 ACATCAGTGGGGAATGGTAGAGG + Intronic
1003921286 6:10835714-10835736 ACTTGAGAAGGGAATGGAAGAGG + Intronic
1006651499 6:35555393-35555415 ACTTTAGGAGGCAAAGGCAGGGG - Intergenic
1007263029 6:40576999-40577021 ACTGGAGGAGGGAATGCTTGTGG - Intronic
1011101128 6:83723882-83723904 ACTTCAAGAGGGTAGGGAAGTGG - Intergenic
1012276191 6:97278157-97278179 ACTTCAGGAGGCCAAGGCAGGGG + Intronic
1012713293 6:102636067-102636089 ACTTCAGGAAGAAATTGGAGGGG + Intergenic
1014772833 6:125476378-125476400 GCTTCAGGAGAGAATGGCAAGGG + Intergenic
1015301137 6:131654068-131654090 GCTTTAGGAGGAATTGGTAGAGG + Intronic
1017520744 6:155199736-155199758 ATTTAAGGAGGGAATGGGACTGG - Intronic
1018183579 6:161245314-161245336 ACTTCAGGAGGTGATGGATGTGG + Intronic
1018287631 6:162257799-162257821 ACTGCAGGAGGAAAGGGTGGAGG - Intronic
1018479767 6:164178716-164178738 ACATTAGGAGGAAATGGTAAAGG + Intergenic
1020587411 7:10086301-10086323 GCTTCAGGAAGGAAGGGCAGTGG - Intergenic
1021245516 7:18256841-18256863 ACTTTGGGAGGGCAAGGTAGGGG + Intronic
1021964671 7:25905798-25905820 ACTTCAGGGGGCAAGAGTAGAGG + Intergenic
1023124559 7:36942539-36942561 ATTTCAGGAGGGAAATGAAGAGG + Intronic
1023480623 7:40629980-40630002 ACTTCAGGAGAGAACGGTTTTGG + Intronic
1024246069 7:47471431-47471453 CATTCAGGATGGAATGGAAGGGG + Intronic
1027250384 7:76395216-76395238 CCTCCAGGCGGGAATGGTAGGGG - Intronic
1028273602 7:88823599-88823621 ATTTCAGTGGGGAATGGCAGTGG + Intronic
1029328274 7:99828766-99828788 ACTTCAGGAGGGAAAGAATGGGG - Intronic
1032125571 7:129189917-129189939 ACATTTGGAGGGAAGGGTAGGGG + Intronic
1033266990 7:139895204-139895226 CCTTGAGGTGGGAATGGTTGGGG + Intronic
1033781640 7:144677665-144677687 ACTTCAGGCTGGAAGGGAAGAGG + Intronic
1033988536 7:147255983-147256005 ACTTCAGGAGGCCAAGGCAGGGG - Intronic
1035005975 7:155661364-155661386 ACTTCAGGAGGCCAAGGCAGGGG - Intronic
1038303270 8:26375724-26375746 AGTTCAGGAGTGACTGTTAGAGG - Intergenic
1039294017 8:36129072-36129094 AAATCAGGTGGGCATGGTAGCGG + Intergenic
1040590746 8:48789988-48790010 CCTCCAGGAGGGAATGGAAGAGG - Intergenic
1042310411 8:67373643-67373665 ACTTCAGCTGGGAAGGGAAGGGG + Intergenic
1042973214 8:74433785-74433807 CCTTCAGGAGGGTATGGTAAAGG + Intronic
1045398033 8:101781404-101781426 TATTCAGGAGGGAATGGTGAGGG - Intronic
1045543745 8:103110170-103110192 ACTTGAGGATGGCAGGGTAGAGG - Intergenic
1045708449 8:104955809-104955831 GCTTCAGGAAGGACTGGCAGAGG - Intronic
1045852933 8:106724783-106724805 ACTTCAGGAAGGAGTTGTAAGGG + Intronic
1047454831 8:124998975-124998997 CTTTCAGAAGGGAATGGGAGTGG - Exonic
1047464666 8:125100708-125100730 AAATCAGCAGGGCATGGTAGTGG - Intronic
1048172106 8:132117151-132117173 GTTGCAGGAGGGAATGATAGGGG - Intergenic
1048459973 8:134613609-134613631 ACTCCAGGAGGGACGGGTATTGG - Intronic
1051699702 9:19808728-19808750 ACTTAAGCAGGGAATGGAACTGG - Intergenic
1055027248 9:71735540-71735562 ACTTCAGGAGGCCAAGGCAGGGG + Intronic
1055576992 9:77670520-77670542 ACTTGGGGAGGGAATGTTAAAGG + Intergenic
1056110603 9:83390902-83390924 ACTTCCTGAGTTAATGGTAGTGG - Intronic
1056438956 9:86601139-86601161 AGATCAGGAGGGAGTGGTAATGG + Intergenic
1057948888 9:99353920-99353942 ACTCCAGGAAGCACTGGTAGAGG - Intergenic
1057974579 9:99591150-99591172 ACTTCAGGAGAGAATGGCAATGG + Intergenic
1059146101 9:111901058-111901080 ACTTCAGGAGGCCAAGGTGGGGG - Intronic
1060102301 9:120851312-120851334 GCTTCAGGAAGGCATGGAAGAGG + Intergenic
1061973045 9:134055019-134055041 ACCTCAGGAGGGCATAGAAGAGG - Intronic
1202801592 9_KI270720v1_random:4279-4301 ACTTCAGGAGGCATAGGAAGAGG + Intergenic
1186318580 X:8398833-8398855 GCATCAGGAGGGATTGGGAGAGG - Intergenic
1187510678 X:19915068-19915090 AGGTGAGGAGGCAATGGTAGGGG + Exonic
1188531643 X:31147438-31147460 ATTTCAGGAGGGGACGGCAGTGG + Exonic
1192331255 X:70177197-70177219 TCTTAAGCAGGGAAAGGTAGTGG + Intergenic