ID: 1079522403

View in Genome Browser
Species Human (GRCh38)
Location 11:21343561-21343583
Sequence ACCCATGGCCTAGACTGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079522403_1079522407 5 Left 1079522403 11:21343561-21343583 CCACAACAGTCTAGGCCATGGGT 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1079522407 11:21343589-21343611 AACTTCTTCTGTAAAGAACCAGG 0: 3
1: 1
2: 14
3: 104
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079522403 Original CRISPR ACCCATGGCCTAGACTGTTG TGG (reversed) Intronic
900279600 1:1857966-1857988 ACCCGTGGCCTTGTCTTTTGAGG - Intronic
900686235 1:3949646-3949668 ACTCATGTACTAGACTGTTAAGG + Intergenic
905434156 1:37945715-37945737 CCCCATGGCCCAGACAGGTGGGG + Intronic
918844350 1:189589659-189589681 AACCATGGCTTAGAATGGTGTGG - Intergenic
920494052 1:206441545-206441567 ACCTTTGGTCTAGGCTGTTGAGG - Intronic
1072550482 10:96473539-96473561 ACCCAATACCTAAACTGTTGGGG + Intronic
1075991111 10:126839611-126839633 ACCCATGGAGCAGACTGTGGGGG - Intergenic
1076124973 10:127966693-127966715 ACCCATGGCTCAGAGAGTTGAGG + Intronic
1078136992 11:8659768-8659790 ACCAATGGCCTGGACAGCTGCGG + Intronic
1079522403 11:21343561-21343583 ACCCATGGCCTAGACTGTTGTGG - Intronic
1089696885 11:120221338-120221360 ACCTATGGCCTAGACAGGTCAGG - Intronic
1103415293 12:120738935-120738957 AGCCATGGCCCAGAATGTGGTGG + Intronic
1110692056 13:78442424-78442446 GCCCATGGCCCAGACTGATTGGG + Intergenic
1113077440 13:106480917-106480939 ACCCACGGCCTGGACAGTTTGGG + Intergenic
1114633602 14:24174868-24174890 ACCCTTTGCCTTGACTCTTGTGG + Intronic
1120706522 14:87751630-87751652 ACCCATGGGCTGGACTTCTGGGG - Intergenic
1122291052 14:100680693-100680715 AACCATGGCCAAGAGTCTTGTGG + Intergenic
1124844318 15:33275656-33275678 ACCCATGCCCTATCCTGTTGTGG + Intergenic
1133457818 16:5958442-5958464 ACCCATGGAATGGACTGTGGTGG - Intergenic
1133584320 16:7177672-7177694 ACCCCTGTCCTAGAATTTTGTGG - Intronic
1138606366 16:58092248-58092270 ACCCAGGGCATAGAGAGTTGAGG - Intergenic
1138932853 16:61682447-61682469 TCCCATTCCCTAGACTGCTGTGG - Intronic
1141290936 16:82717602-82717624 AGCCAGGGACTAGACTGATGTGG - Intronic
1145250904 17:21296530-21296552 AGCCATGGCCTGGCCTGTTGGGG + Intronic
1145815398 17:27791739-27791761 ACACCTGGTCTAGACTGGTGTGG + Intronic
1152552828 17:81038373-81038395 ACCCATGACCTGGAGTGTGGCGG + Intronic
1155694559 18:28670003-28670025 AACCATGGACTAGCCTGCTGAGG - Intergenic
1157983317 18:52407846-52407868 ACCCATGGCCTACATTTCTGTGG + Intronic
1159821723 18:73154377-73154399 CCCACTGGCCTAGACTGTGGTGG + Intronic
1160575146 18:79848910-79848932 ACCCACGGCATAGGCTGTTAGGG + Intergenic
1160867332 19:1261683-1261705 ACCCGTGGCCTGGACTTTGGGGG + Intronic
1162178722 19:8851543-8851565 ACCCATGGCAAAGACTATTGAGG - Intronic
1167502736 19:49856839-49856861 GGCCATGGCCTTGACTGTGGGGG + Intronic
1167932517 19:52877814-52877836 ACCCTTGGACTTTACTGTTGTGG - Exonic
926801352 2:16663717-16663739 ACCCTTGACCTGAACTGTTGAGG - Intronic
932308016 2:70717542-70717564 ACCCATGGCCATGGCTGTTGGGG - Intronic
932374914 2:71227012-71227034 ACTAAAGGCCGAGACTGTTGTGG - Exonic
935712701 2:105913371-105913393 AACCATGGCCCTGACTGATGTGG + Intergenic
935758343 2:106295842-106295864 ACTGATGTCCTAGGCTGTTGGGG + Intergenic
938165841 2:129026148-129026170 ACCCATGTCCAAGTCTGTTTCGG + Intergenic
940864567 2:158804968-158804990 ACCCAAGGCCTAGACTGGTTGGG - Intronic
944937033 2:204580099-204580121 ACCCATAGTCTAGACTCTGGAGG + Intronic
1171069480 20:22053756-22053778 ACCCATATCCTAGATTCTTGGGG - Intergenic
1174227981 20:49020228-49020250 AGCTATGGCCTAGCATGTTGAGG - Intronic
1183258806 22:36780931-36780953 AGCCAGGGACTAGACTGTTGGGG + Intergenic
953454472 3:43030772-43030794 ACCCATGACCTAAGCTGATGGGG - Intronic
954839811 3:53500581-53500603 AACCATGGCCTTGCCTCTTGTGG + Intronic
957553172 3:81732979-81733001 ACCCCTGGCCTAGAGTATTCAGG - Intronic
972872053 4:43312534-43312556 ACCCCTGCCCTAGAGAGTTGTGG + Intergenic
977957970 4:103052370-103052392 ACCCATGAGCTAGACTAATGTGG + Intronic
985255354 4:188064430-188064452 AGCAATGGCCAAGGCTGTTGTGG - Intergenic
987792048 5:22580868-22580890 GCCCATGGCCTAGAGATTTGTGG + Intronic
995869745 5:116732216-116732238 AGCCATGGCCTGGAGGGTTGAGG + Intergenic
998387639 5:141766981-141767003 ACCCATGGCCTAAAGTGAAGGGG - Intergenic
998678483 5:144437106-144437128 ACCTGTGGCCTAGCCTGTTGAGG - Intronic
999263184 5:150250188-150250210 TCCCATGGCCAGGACTGTGGAGG + Intronic
1001270653 5:170309165-170309187 AGCCCTGGTCTAGAGTGTTGTGG + Intergenic
1001861151 5:175056899-175056921 ACCCAGGGCCCATTCTGTTGTGG - Intergenic
1006441197 6:34054684-34054706 ACCCAGTGCCTAGGCTGTCGAGG - Intronic
1006555655 6:34864005-34864027 GCCCATGGCCAAGACAGATGAGG + Exonic
1013925661 6:115468627-115468649 ACCCATGCCCTATGCTGCTGTGG + Intergenic
1017081295 6:150671470-150671492 ACCAGTGCCCCAGACTGTTGAGG + Intronic
1021808747 7:24381993-24382015 GCCCATGTCATAGACTGTTCGGG + Intergenic
1035277556 7:157757212-157757234 ACCCATGGCCAATTCTGCTGTGG - Intronic
1037720462 8:21439333-21439355 ACCCCGGGCCTAGGCAGTTGTGG - Intergenic
1037991884 8:23327170-23327192 ACCCATGCCCTAGCCTGCAGTGG - Intronic
1038909668 8:31948812-31948834 ACCCATGGCACATCCTGTTGGGG - Intronic
1041935560 8:63327872-63327894 GCAAATGGCCAAGACTGTTGGGG + Intergenic
1052827092 9:33185078-33185100 ACCCCTGGCCCAGACAGCTGTGG - Intergenic
1053523723 9:38807967-38807989 ACTCATGGCCTAGACCCTTCAGG - Intergenic
1054195952 9:62032381-62032403 ACTCATGGCCTAGACCCTTCAGG - Intergenic
1054642453 9:67556308-67556330 ACTCATGGCCTAGACCCTTCAGG + Intergenic
1186614297 X:11170613-11170635 TGCTGTGGCCTAGACTGTTGTGG - Intronic
1186616060 X:11189279-11189301 TCCCATTGCCTAGCTTGTTGTGG - Intronic
1193568600 X:83112261-83112283 ACCCATGGCATAGTCTTTTTTGG + Intergenic
1194532478 X:95068715-95068737 ACCAATGTCCTACACTGCTGTGG - Intergenic
1195502713 X:105620951-105620973 ACCCATGGCCTTGGCTTCTGAGG + Intronic
1196660487 X:118264104-118264126 ACCGATGCCCTATCCTGTTGTGG - Intergenic
1197363244 X:125533057-125533079 ACCCATGCCCTATTCTGCTGTGG + Intergenic
1197710537 X:129663567-129663589 AGCCAGGGCAAAGACTGTTGAGG + Intergenic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1198086522 X:133287532-133287554 AACCTTGGCCAAGACTGTTCAGG - Intergenic
1200700149 Y:6395236-6395258 CCCTATGGCCTAGACTTTTTGGG - Intergenic
1201033962 Y:9769462-9769484 CCCTATGGCCTAGACTTTTTGGG + Intergenic