ID: 1079522500

View in Genome Browser
Species Human (GRCh38)
Location 11:21344855-21344877
Sequence CTGGAGAAGCAGAATAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079522500 Original CRISPR CTGGAGAAGCAGAATAATTA AGG (reversed) Intronic
900461644 1:2804754-2804776 CTGGGGAAGCAGATTACTTTGGG + Intergenic
901110437 1:6789076-6789098 TTGCAGAAGCAGGATAAGTAAGG - Intronic
903119735 1:21207745-21207767 CTGAATAAGCAGAAGAGTTATGG + Intergenic
905280084 1:36843596-36843618 CTGGAAAAGCAGATTAACTCCGG - Intronic
905664448 1:39754272-39754294 CTAGAGAAGCAGAACCAATAGGG + Intronic
911241223 1:95469796-95469818 CTGATCAAGCAGAAGAATTAGGG - Intergenic
911453778 1:98097873-98097895 TTAGAGAAGCAAAATAATTGTGG - Intergenic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
914386952 1:147178947-147178969 CTGGAGAAACAGGGTAATGATGG + Intronic
916145656 1:161736734-161736756 CTAAAGAAGCAGAAAAATCATGG + Intergenic
916821406 1:168402344-168402366 CTGGTGCAGCAGGATAATTTAGG + Intergenic
920385287 1:205567241-205567263 CTAGAGAAGCAAAATCATTAGGG + Intergenic
920751662 1:208683656-208683678 ATGAATAAGCAGAATAGTTATGG + Intergenic
920754471 1:208715997-208716019 CTGGATCAGCAGAATGATTTTGG + Intergenic
921721302 1:218474803-218474825 TTGGAGCAGCAAAATGATTAAGG + Intergenic
921898885 1:220429424-220429446 TTGGAGAGGCAGAATAACAATGG + Intergenic
922132227 1:222791102-222791124 CTGGTGAAGAAGAATTACTAGGG + Intergenic
922933062 1:229404915-229404937 CTGGATAAACAGAAGTATTATGG + Intergenic
923125925 1:231034437-231034459 CTGGAGAAGCACATGAATCAAGG - Intronic
923361458 1:233215835-233215857 AAGTAGAAGCAGCATAATTAGGG - Intronic
923440901 1:234019289-234019311 CTGGAGAACCAGACTAATATAGG - Intronic
924237026 1:242007686-242007708 CTGGAGAAGGGGCATAAGTATGG - Intergenic
924926137 1:248683064-248683086 CTTGAGAAAAAGAATAATAACGG - Intergenic
1064490113 10:15846607-15846629 CTGTAGAGGAAGAAAAATTATGG - Intronic
1064595512 10:16940897-16940919 CTGGAGAGGCAGCAAAATTATGG + Intronic
1065845967 10:29743644-29743666 ATGGAGAAGCAGATAAACTACGG - Intergenic
1066695025 10:38069629-38069651 CTGGAGAATCAGAAGACTTGGGG + Intergenic
1069102668 10:64342419-64342441 CTGGAGAAGGAGAGGTATTATGG - Intergenic
1072173450 10:92891075-92891097 CTGGAGAAGGAGAATAGTCAAGG + Intronic
1074255617 10:111799497-111799519 CTGGGGAACCAGAATAGTTGTGG - Intergenic
1074326925 10:112459532-112459554 CTGAAGAAGCAGAGTCTTTATGG + Intronic
1074569682 10:114613213-114613235 CTGCAGAATCAGTATAATTGGGG - Intronic
1076575962 10:131468332-131468354 CTGGAGAGGCCTCATAATTATGG + Intergenic
1076729596 10:132431784-132431806 CTGGAGAAGGAGAAATATTCTGG + Intergenic
1077836512 11:5931512-5931534 TTGTAGAAGCCGAATAATAATGG - Intronic
1079522500 11:21344855-21344877 CTGGAGAAGCAGAATAATTAAGG - Intronic
1079698429 11:23513639-23513661 CTGGAGAGGCCTCATAATTATGG + Intergenic
1080000416 11:27342059-27342081 CTGGGGAAGCCTAATAATCATGG - Intronic
1080129923 11:28782061-28782083 CTGGAGAAGCCTTACAATTAAGG + Intergenic
1080156097 11:29112948-29112970 CTTTATAAGCAGGATAATTAAGG + Intergenic
1081411790 11:42767516-42767538 CTTGAGCAGCAGAATAAATATGG - Intergenic
1083252723 11:61478612-61478634 CTGGAGAATGAGTATAATAATGG - Intronic
1086282670 11:85209118-85209140 CTGTAGAAGATGAATAGTTAGGG - Intronic
1087379123 11:97381995-97382017 CTGGAGAAGCCTCATGATTATGG + Intergenic
1087531916 11:99393694-99393716 CTGGACAACCATAATATTTAAGG - Intronic
1088612850 11:111594758-111594780 CTAGAGAAGCACAAAAATAAGGG + Intergenic
1090505499 11:127308544-127308566 TTGGAGAATTAGAATAGTTAAGG + Intergenic
1091112825 11:132986371-132986393 GTGAAGAAACAGAATAATTAAGG + Intronic
1092482121 12:8869121-8869143 CTGGAGAAGCTGAATAAGAGAGG - Exonic
1093167955 12:15827302-15827324 CTTGAGAAGCAGTATACTTGGGG + Intronic
1093207211 12:16264833-16264855 CTGGAGAAGCCTCATAATCATGG - Intronic
1095262595 12:40113942-40113964 CTTGAGAATGAGAACAATTAAGG - Intergenic
1095508141 12:42920454-42920476 CTGGGAAAGCATAATAAATATGG - Intergenic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1099486637 12:83236891-83236913 CTGGAAGATCAGAACAATTAAGG - Intergenic
1099504000 12:83449626-83449648 CCAGAGAAGCAGAACAAATAGGG + Intergenic
1099557801 12:84131425-84131447 GTGGAGAAGCAGAAGACATATGG + Intergenic
1100718248 12:97328265-97328287 CTGGGGAAGCAGAGTAATCTAGG - Intergenic
1102972448 12:117180491-117180513 CTGGAGAAGCAGAATTCTCCTGG - Intronic
1103024708 12:117564089-117564111 CTGGAGAACCAAATTCATTAGGG - Intronic
1104181674 12:126387747-126387769 CTAGAGAAGCAGAACCAATAGGG + Intergenic
1105646157 13:22320043-22320065 ATGGAGTAGCAGAACAATTAAGG - Intergenic
1107072492 13:36286284-36286306 CTGGAGAAGCTGAGAAACTATGG + Intronic
1107499912 13:40963281-40963303 TTAGAAAACCAGAATAATTAAGG + Intronic
1107868677 13:44727873-44727895 CTGGGGGAGCAGAATTTTTAAGG - Intergenic
1107879637 13:44821891-44821913 CTGGAGAAAAAGAATAGTTCTGG - Intergenic
1110480699 13:75972341-75972363 CTGTAGATGCAAAATAAATAAGG + Intergenic
1110560767 13:76908770-76908792 CTGGGGAAGCAGAAAAAAGATGG - Intergenic
1111529758 13:89521588-89521610 AAGGAGAACAAGAATAATTAAGG + Intergenic
1114152861 14:20064322-20064344 CTGCACAAGCAGAATAACTCTGG - Intergenic
1114402305 14:22421056-22421078 CTGCAGAAGCAGAAGGACTATGG - Intergenic
1117838146 14:59829036-59829058 CTGAAGCAGCTGAATAATGATGG + Intronic
1120533574 14:85664311-85664333 CCGGGGAAGCAGAATGATGAGGG + Intergenic
1121180451 14:91925195-91925217 CCGGGGAAGCAGAATACTTGGGG - Intronic
1123798259 15:23795315-23795337 CTTGAGCAGCAAAATAATTAAGG + Intergenic
1124061319 15:26296198-26296220 CAGCAGAAGCAGAAGAATTTGGG - Intergenic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126554776 15:49973697-49973719 CTCCAGAAGCAGAATTTTTATGG + Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128591734 15:68904039-68904061 CTGAACAATCAGAATAAATACGG - Intronic
1129291891 15:74574653-74574675 CTGGAGGAGCAAACTAATTAAGG - Intronic
1134795117 16:17028042-17028064 CTGGATAAACAGAATAACTATGG - Intergenic
1135272168 16:21078793-21078815 CTGGAGAAGCTCATTAACTATGG + Intronic
1136292474 16:29284149-29284171 ATTGAGAAACAGAAAAATTATGG + Intergenic
1137800213 16:51256024-51256046 CTGGAGGAGCAGAACAGCTATGG + Intergenic
1138321211 16:56113630-56113652 CTGAAGAGGCAGAATCATGAAGG - Intergenic
1141275545 16:82584645-82584667 ATGGAGAAGAAGAAGAAGTAGGG + Intergenic
1141713145 16:85711786-85711808 CAGGAGAAGCTGAGTAATAAGGG + Intronic
1142098367 16:88258168-88258190 ATTGAGAAACAGAAAAATTATGG + Intergenic
1142675240 17:1509208-1509230 CTGGAGATGCAGAATTGTGAGGG - Exonic
1148616861 17:49007279-49007301 CTACAGAAGCAGAAGAAGTAGGG - Intronic
1149042757 17:52209979-52210001 CTGGGGAAGCCCCATAATTATGG + Intergenic
1151017758 17:70576925-70576947 CTGGGGAAGGAGAATACATAAGG - Intergenic
1151827862 17:76533337-76533359 CTGGAGAAGCACTGTAATGAGGG + Intronic
1155779699 18:29815493-29815515 CTTGAGAACCAGAATAAGCAAGG + Intergenic
1156889915 18:42178880-42178902 GTTCAGAAGCAGAATAATTGAGG + Intergenic
1157631144 18:49097302-49097324 CTGGATAAGCAGCATGATTCTGG + Intronic
1157656209 18:49391646-49391668 CTGGAGAGACAGAAGAATAAAGG + Intronic
1158061356 18:53347726-53347748 CTGGGGAAGCATCACAATTATGG + Intronic
1158552323 18:58446507-58446529 CTGAGGAAACAGAATAATCATGG - Intergenic
1158784840 18:60698108-60698130 CTGGAGAAGAAGTAAAATCATGG - Intergenic
1158965116 18:62615882-62615904 CTAGAGTATCAGAATAATTCTGG + Intergenic
1163598695 19:18235016-18235038 CTGGAAAAGAGGAATAATAATGG + Intronic
1165173239 19:33907706-33907728 CTGGAGAAGTGTAAAAATTAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167016497 19:46844349-46844371 CTGGGGCAGGAGAATACTTAGGG - Intronic
1167813802 19:51860392-51860414 CTGCTGAAGCAGAATAGATATGG + Intronic
1168651204 19:58093414-58093436 ATGGAGAAGCAGGATAGCTAGGG + Intronic
927213560 2:20653129-20653151 CTGGAGAAGGAGCATATTTTTGG + Intergenic
927715907 2:25352723-25352745 CTGGAGAAGCAGCAGAAATGGGG - Intergenic
929391678 2:41475682-41475704 CTGGGAAAGGAGAAGAATTAGGG - Intergenic
929802654 2:45117480-45117502 TTGGGGAAGCAAAATAATTTTGG + Intergenic
930196123 2:48512205-48512227 CTGGGCAAGCAGAAGGATTATGG - Intronic
930682696 2:54274121-54274143 CTGGGGAAGCCTCATAATTATGG + Intronic
931054709 2:58456315-58456337 TTGGAGAATCAGAATAATCCAGG + Intergenic
932731274 2:74223805-74223827 CTGGAAGAGCACAGTAATTAAGG + Intronic
933813409 2:86047598-86047620 CTGGAGAAGAATAAAATTTAAGG + Intronic
934090056 2:88543370-88543392 ATGGAGAAGCAGGATAATCCAGG + Intergenic
935623502 2:105149008-105149030 CTTCAGAAGTACAATAATTATGG - Intergenic
936160053 2:110078058-110078080 CTGGAGAAGCAGCAGGATTTGGG - Intergenic
936184611 2:110293295-110293317 CTGGAGAAGCAGCAGGATTTGGG + Intergenic
936294089 2:111252090-111252112 CTGGAGAAGCAGAATCAACTGGG - Intergenic
936731518 2:115386740-115386762 ATTGAGAAGCAGCATATTTAAGG - Intronic
938369108 2:130757588-130757610 CAAGAGAAGTAGAATATTTAAGG - Intronic
939775800 2:146386213-146386235 CTGGATCAGCAGAATAAATGTGG - Intergenic
940008197 2:149029265-149029287 CTGAAGAAGCAGAAGAATATAGG - Intergenic
940724686 2:157323310-157323332 CATTGGAAGCAGAATAATTAGGG + Intronic
945350239 2:208769042-208769064 CTGGAAAGGCAGAATGATTTTGG - Intronic
945662666 2:212705835-212705857 GTGATGAAGCAGAATAATAAGGG - Intergenic
947334217 2:229064797-229064819 CTGGAGTAAAAGCATAATTAAGG + Intronic
947466540 2:230354106-230354128 CAGGAGAAACAGAAATATTATGG - Intronic
1168749051 20:269206-269228 CTGGAGTAGCTGATTAATGATGG - Intergenic
1168932837 20:1637839-1637861 CTGGAGAATCAGAAAAATGAGGG + Intronic
1169135510 20:3194869-3194891 CTAGAGAAGCAGAGAAATCAGGG + Intronic
1169718636 20:8647874-8647896 TTGGAGAAGCAGAAAAACAAGGG - Intronic
1173986060 20:47262420-47262442 CTGGTGAAGCTGAAAAAGTATGG + Exonic
1175683140 20:61005948-61005970 GGGGAGAAGCAGAACCATTAGGG + Intergenic
1176695876 21:9977591-9977613 CTGGAGAGGCATCATAATCATGG - Intergenic
1177827368 21:26098927-26098949 CTGGAGAACCTGAATAGTTAAGG + Intronic
1178829356 21:36042346-36042368 TTGGAGAAGCAGGGTAATAAGGG + Intronic
1180724716 22:17938254-17938276 GTGGGGAAGTGGAATAATTACGG - Intronic
1181058777 22:20272177-20272199 ATGAGGAAGCAGATTAATTATGG - Intronic
1181685722 22:24526581-24526603 CTAGAGAAGCAGAACCAGTAGGG - Exonic
1184931468 22:47684277-47684299 TTTGAGAAGCAGAAAAAATAAGG - Intergenic
1184994612 22:48196388-48196410 CTGGGCAAGCACATTAATTACGG + Intergenic
949871569 3:8593909-8593931 CTGGAGAATGTGAATAATTTAGG - Intergenic
951164769 3:19471639-19471661 CTAGATAAGGAGACTAATTAAGG + Intronic
952397231 3:32931510-32931532 CTGGGGAAGCCTAACAATTATGG - Intergenic
955515162 3:59719185-59719207 ATCGAGAAGCACAAGAATTAGGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956315305 3:67928490-67928512 CTGGTGAAGCTGAAAAGTTAGGG + Intergenic
958702316 3:97608980-97609002 CTGCATAAGAAAAATAATTATGG + Intronic
958868429 3:99528333-99528355 ATGAAGAAGAAAAATAATTAAGG - Intergenic
958987840 3:100803207-100803229 CTGGATAAAAAGAATAAATAGGG + Intronic
959563404 3:107808945-107808967 CTGGAGAAACAAAATAATGATGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
963812638 3:149794050-149794072 CTGGAAAAGAAGAGTAATGAGGG + Intronic
964532523 3:157683795-157683817 CTGGAGCAGCAGATTAAATCAGG - Intergenic
965972309 3:174575348-174575370 CTGAAGATGCTGAATAACTAAGG - Intronic
966640974 3:182189648-182189670 CTGGAGAATGATAAGAATTAAGG - Intergenic
970119907 4:12741965-12741987 CTGAGGAAGTAGAATAATGAAGG - Intergenic
971827207 4:31640573-31640595 CTGGGGAGGCTGAATAAATAGGG + Intergenic
974201048 4:58641002-58641024 TTGGAGAAGCAGAGTACTGAGGG - Intergenic
974518099 4:62942634-62942656 CTGCAGAATCAGAAAATTTAAGG - Intergenic
976679605 4:87741121-87741143 GTGGAGACTAAGAATAATTATGG + Intergenic
977863837 4:101999948-101999970 CTGGAGAGGCAAAGTAATGAAGG + Intronic
978453682 4:108864593-108864615 CTGCAGAACCAAAATAGTTAAGG + Intronic
980005665 4:127539634-127539656 GTGGAGAAGCAGAGCATTTAGGG - Intergenic
980368494 4:131837832-131837854 CTGGAGAGGCATCATAATCATGG - Intergenic
980445673 4:132904216-132904238 CTGCAGAAGAAAAATAATTGTGG + Intergenic
983302675 4:165947297-165947319 CTGGAGTAGGAAAGTAATTAAGG - Intronic
984200084 4:176708550-176708572 CTTGAGCAGCACCATAATTAAGG + Intronic
984240325 4:177210987-177211009 CTTGAGAAGCAGAGTCATTCTGG - Intergenic
984406255 4:179334956-179334978 CAGGAGAAAGAGAATAATGATGG + Intergenic
986358662 5:6953185-6953207 TTGGAGGAGAAGAATAATTCTGG - Intergenic
988075548 5:26349432-26349454 CTGGAGTTGCAGCATAGTTATGG - Intergenic
988282573 5:29169019-29169041 CTGAAAAAGGAAAATAATTATGG + Intergenic
989233149 5:39110575-39110597 CTGGAGAAAGAGAAAAGTTAGGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990276310 5:54200852-54200874 CTGCAGAAGAAGTATAATTATGG - Intronic
991982766 5:72250412-72250434 CTGGAGAAGCAGCATTACTGTGG - Intronic
992190839 5:74290248-74290270 CTGGAGAATCAGGATCTTTAAGG - Intergenic
992335669 5:75766240-75766262 CTGGGGAGGCAGAACAATCATGG - Intergenic
994977579 5:106829672-106829694 CTGGAGAAGCTGACCAATGACGG + Intergenic
996488369 5:124063548-124063570 CTAAAGAAGCAGAATCAATAGGG + Intergenic
999564046 5:152837980-152838002 CTGTAGAAGATGAATAATGAGGG + Intergenic
999877401 5:155823224-155823246 CTGGAGACCCAGAAAAGTTATGG + Intergenic
1000356058 5:160396947-160396969 CTGGAGAATCAGAATCTCTATGG - Intronic
1000440786 5:161260632-161260654 CTGGGGAAACAGAATAAAAATGG + Intergenic
1003767598 6:9258258-9258280 CTGAAGAGGCAGCATAATTTTGG + Intergenic
1004264670 6:14138662-14138684 ATGGAGATGAAGAATAAATATGG - Intergenic
1004272611 6:14209417-14209439 TTGGAGAAGCATAACCATTAAGG + Intergenic
1004577638 6:16912887-16912909 AAGGAAAAGCAGAATATTTAAGG + Intergenic
1004628465 6:17398887-17398909 CTGGAGATGGACAATAATAATGG - Intronic
1004724671 6:18299761-18299783 CTGGAGAAATTGAATCATTAAGG - Intergenic
1005214615 6:23510705-23510727 TTGGACAAGCAGAATAATAGTGG + Intergenic
1005633008 6:27726278-27726300 CTGGACAGGCAGAATCATTGGGG + Intergenic
1005753077 6:28901687-28901709 CTGGAACAGCAAAAGAATTAAGG + Intergenic
1006665689 6:35691386-35691408 CTGGAAAAGCCTAATAATTGAGG + Intronic
1009539319 6:64931891-64931913 GGGGAGAAGGAGAATAAATATGG - Intronic
1014320812 6:119925889-119925911 CTGTAGGAGAAGAAAAATTAGGG - Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014895480 6:126894946-126894968 CTGTATAAGCAGAAAAATTCTGG + Intergenic
1015120109 6:129692060-129692082 CTGGAAGAGGAGAACAATTATGG - Intronic
1016031150 6:139339683-139339705 CAGGAGAGGCAGACAAATTATGG - Intergenic
1016147704 6:140695970-140695992 CTAGAGGAGCAGAATATTAAGGG - Intergenic
1016791263 6:148069352-148069374 CTGGCTAAGAAGAATCATTAGGG - Intergenic
1018095330 6:160382426-160382448 CTGCAGAAGCTGAAAAATTTAGG + Intronic
1018675399 6:166217219-166217241 CTGTAGAGCTAGAATAATTAAGG + Intergenic
1018776179 6:167018332-167018354 CTGGACAAGCACAAAAGTTATGG - Intronic
1021152464 7:17168056-17168078 CTGGGGAAGTAGAATACTCAAGG - Intergenic
1022325038 7:29323413-29323435 CTGTGGTAGCAGAATAATGAGGG - Intronic
1023054287 7:36279174-36279196 CTGGTGAAGCAGAAAACTCAAGG - Intronic
1023171550 7:37394523-37394545 CTGCAGAAGGAGAATAATTGGGG + Intronic
1023300965 7:38770474-38770496 GTGCAGAAGCAAAATAATTTAGG - Intronic
1024276115 7:47678443-47678465 CTGAAAAGGCAGAATAATTTGGG + Intergenic
1024421951 7:49178482-49178504 CTGGAGTAACAGAATTATTTGGG - Intergenic
1024507187 7:50171812-50171834 CTAGAGAAGCAGAACCAGTAAGG - Intergenic
1026245906 7:68619275-68619297 CGGGAGAAGCAGAGTTAATAGGG + Intergenic
1028186119 7:87786943-87786965 CTGGAGCAACAAAATAATTATGG + Intronic
1028453157 7:91008291-91008313 CGGGATAACCAGAATAATCAAGG + Intronic
1032319538 7:130873559-130873581 CATGAAAAGCAAAATAATTAAGG - Intergenic
1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG + Intronic
1033367835 7:140684829-140684851 CTGGAGAAGCAGGATTGTTGAGG + Intronic
1033818267 7:145102044-145102066 ATGGAGAAGAAGAAGAATTTGGG - Intergenic
1034035057 7:147811035-147811057 CTGGAGAACAAGACTAACTAAGG - Intronic
1034698422 7:153075440-153075462 CCAGAGAATCAGAATAATTAAGG - Intergenic
1036142431 8:6220615-6220637 TTGCAGAAGCAGATGAATTATGG + Intergenic
1037027324 8:14055216-14055238 CTGGAGAAGCCTCATAACTATGG - Intergenic
1037933072 8:22895317-22895339 CTGGAGAGGCATAATAATGTTGG + Intronic
1040393733 8:46974711-46974733 AGGGAGAAGAAAAATAATTATGG + Intergenic
1041954278 8:63540256-63540278 CTGGAGAACCAGAAAACTGATGG + Intergenic
1042369468 8:67975051-67975073 CTTGAGAAGAAGAATAATAAAGG - Intronic
1042434771 8:68750712-68750734 TTGGAGAATCAGAATGCTTAGGG + Intronic
1042786737 8:72556022-72556044 GTGGAAAATCATAATAATTATGG - Intronic
1043653639 8:82632954-82632976 CTGGAGAAACAAAAAAATTAAGG + Intergenic
1043783108 8:84361980-84362002 CTGGAAAATAAGAATTATTATGG - Intronic
1044087005 8:87954563-87954585 CTGGAGAAGCCTCATAATCATGG + Intergenic
1044357536 8:91241029-91241051 CCTTAGAAGCAGAATTATTAGGG - Intronic
1044556110 8:93563640-93563662 TTGGTGAAGCAGACTACTTATGG - Intergenic
1044905570 8:96998020-96998042 CAGGATAAGCAGAAGAATAAAGG - Intronic
1045596979 8:103668277-103668299 CTGGACAAGTAAAATAAATAAGG - Intronic
1046675725 8:117105871-117105893 CTGGAAATGCAGAAGAAATAGGG - Intronic
1047535742 8:125718160-125718182 CTAGAGAAACAGAACCATTAGGG + Intergenic
1048760425 8:137788470-137788492 CTGGAGAACAAGACTAAATAGGG - Intergenic
1049302321 8:141878159-141878181 CTGGAGAAGCAAAATATTCCTGG - Intergenic
1050159651 9:2704260-2704282 ATGGAGAAGAAAAATAAATAAGG + Intergenic
1050539319 9:6656632-6656654 CAAGAGAAGCAGAATTATAAAGG + Intergenic
1050930968 9:11326081-11326103 CTTCAAAAGGAGAATAATTAAGG - Intergenic
1050964848 9:11786628-11786650 CTGGAGAAGTAGAAATAATATGG - Intergenic
1051154737 9:14128769-14128791 CTGGAGAAGAGGATCAATTAAGG + Intronic
1052471442 9:28900657-28900679 CTGGACAAGCTGAATGATAAAGG + Intergenic
1053772899 9:41499990-41500012 CTGGAGAGGCATCATAATCATGG + Intergenic
1054313952 9:63561700-63561722 CTGGAGAGGCATCATAATCATGG - Intergenic
1056461075 9:86810394-86810416 GTGGAGAAGAAGAACAATTCTGG + Intergenic
1058130775 9:101250477-101250499 CTAGGGAAGCAATATAATTAAGG - Intronic
1058655484 9:107216849-107216871 CTGGAGAAGCAGATAACTTGGGG + Intergenic
1059734141 9:117085062-117085084 CTGGAGAAGCTGAATATTTAGGG - Intronic
1186202930 X:7172241-7172263 CTGTAGAAGCAGCATCCTTAAGG + Intergenic
1187541676 X:20202499-20202521 TTGGAAAAGAAGAATAATAAGGG - Intronic
1189920988 X:45903232-45903254 CTGGTGAAGTAGAATAAATTTGG + Intergenic
1191963177 X:66726189-66726211 CTGGAGAATTAGGCTAATTAGGG + Intergenic
1193156513 X:78180072-78180094 ATGGAGAACCAGAATATGTAGGG - Intergenic
1194044007 X:88979262-88979284 CCAGAGAAACAGAATAAATAGGG + Intergenic
1194484982 X:94475391-94475413 CTGCAGCAGCCTAATAATTAAGG + Intergenic
1195502808 X:105622222-105622244 CAGTAGAAGCACAATAAATAAGG + Intronic
1197516715 X:127441142-127441164 CTGGAGAAGGGGAACAAGTAAGG - Intergenic
1197814502 X:130483065-130483087 CTGGAGTAGCCGCATGATTATGG - Intergenic
1198868731 X:141153713-141153735 CTGGAGAAACAGAGCAAATAGGG + Intergenic
1199458442 X:148055897-148055919 CTGGAGAAGCAGGATAGGTGAGG + Intergenic
1200373195 X:155749724-155749746 CTGGGGAACTAGAATAACTAAGG + Intergenic