ID: 1079523276

View in Genome Browser
Species Human (GRCh38)
Location 11:21354346-21354368
Sequence GAGAGTAGAAAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2205
Summary {0: 1, 1: 0, 2: 15, 3: 252, 4: 1937}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079523276_1079523284 17 Left 1079523276 11:21354346-21354368 CCTCCCTCCTTCTTTCTACTCTC 0: 1
1: 0
2: 15
3: 252
4: 1937
Right 1079523284 11:21354386-21354408 CTTAGTTAAAACTTCAAACCAGG 0: 1
1: 0
2: 0
3: 13
4: 147
1079523276_1079523285 30 Left 1079523276 11:21354346-21354368 CCTCCCTCCTTCTTTCTACTCTC 0: 1
1: 0
2: 15
3: 252
4: 1937
Right 1079523285 11:21354399-21354421 TCAAACCAGGTTTCTCTCATTGG 0: 1
1: 0
2: 0
3: 16
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079523276 Original CRISPR GAGAGTAGAAAGAAGGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr