ID: 1079523855

View in Genome Browser
Species Human (GRCh38)
Location 11:21361645-21361667
Sequence CAGAATCCCACATTTCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11324
Summary {0: 1, 1: 18, 2: 428, 3: 7234, 4: 3643}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079523850_1079523855 5 Left 1079523850 11:21361617-21361639 CCAATTATCCTTATGTTTGCCCA 0: 1
1: 0
2: 6
3: 87
4: 503
Right 1079523855 11:21361645-21361667 CAGAATCCCACATTTCTTGGAGG 0: 1
1: 18
2: 428
3: 7234
4: 3643
1079523851_1079523855 -3 Left 1079523851 11:21361625-21361647 CCTTATGTTTGCCCATTTAACAG 0: 1
1: 0
2: 4
3: 13
4: 197
Right 1079523855 11:21361645-21361667 CAGAATCCCACATTTCTTGGAGG 0: 1
1: 18
2: 428
3: 7234
4: 3643

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079523855 Original CRISPR CAGAATCCCACATTTCTTGG AGG Intronic
Too many off-targets to display for this crispr