ID: 1079525742

View in Genome Browser
Species Human (GRCh38)
Location 11:21385530-21385552
Sequence ATACTAGGAGGTAGGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079525742 Original CRISPR ATACTAGGAGGTAGGATGGA GGG (reversed) Intronic
903384738 1:22918957-22918979 ATCCCAGGAGGTGGGAAGGAAGG - Intergenic
903670323 1:25031462-25031484 ATACAAGGATGGAGGCTGGAGGG + Intergenic
903972440 1:27127799-27127821 GCATTTGGAGGTAGGATGGAGGG - Intronic
906633128 1:47389155-47389177 CTGCTAGGAGGGAGGAGGGATGG - Intergenic
906838460 1:49109485-49109507 ACACTGGGAGGAAGGAAGGACGG - Intronic
906941083 1:50256040-50256062 GTCCTAGGAGGTAGGATTCATGG + Intergenic
907915590 1:58865897-58865919 AGAGTAGGAGTTAGGATGGATGG + Intergenic
908921741 1:69202719-69202741 AAACAAGGAGGAAGGAAGGAAGG + Intergenic
910780476 1:90926994-90927016 ATACTAGGAAGTAGGAGGTAAGG - Intronic
911549388 1:99261192-99261214 ATACTTGTAGGTTGAATGGATGG + Intergenic
911774531 1:101791510-101791532 TTGCTAGGAGTTAGGAGGGAGGG + Intergenic
912168068 1:107063516-107063538 AAAAGAAGAGGTAGGATGGAAGG + Intergenic
915363640 1:155301223-155301245 AAACTAGGAGCCAGGGTGGAGGG - Intronic
916795786 1:168165843-168165865 TTGCTAGGATGTTGGATGGATGG - Intergenic
918076652 1:181175895-181175917 ATAGAAAGTGGTAGGATGGAAGG + Intergenic
918317035 1:183331038-183331060 AAAGTAGGAGGAAGGAAGGAAGG - Intronic
920074067 1:203324328-203324350 ACACTAGGAGGTAGGGCGGTGGG + Intergenic
920587347 1:207179571-207179593 ATTCTAGGAGGTAGGAGTCAGGG + Intergenic
920972739 1:210756668-210756690 GTACTGGGAATTAGGATGGAAGG + Intronic
921513630 1:216063286-216063308 ATACTAGGAAGTGAGATGGAAGG - Intronic
922166747 1:223122087-223122109 AACCTTGGAGGTAGGAGGGATGG - Intronic
922323002 1:224503944-224503966 AAACTTGGAGGTGGGGTGGAGGG + Intronic
924038532 1:239960117-239960139 TTACTAGGAAGGAGGAAGGAAGG - Intergenic
924474726 1:244372941-244372963 ATTTTAGGAGATAGGATGGAGGG - Intronic
1063645673 10:7880394-7880416 ATATTAGGTGGTAGTCTGGAGGG + Intronic
1064405467 10:15058869-15058891 ATACTAGGGGGTAGGAAGGGAGG - Intronic
1064768257 10:18696899-18696921 ATACTAGGAGGCAGGAATCATGG - Intergenic
1065145826 10:22767035-22767057 CCTCTAGGAGGTAGGAAGGAAGG + Intergenic
1067352099 10:45485663-45485685 ATACTAGGAGGCATGATTAAAGG + Intronic
1068030263 10:51697961-51697983 ATACAAGGAGGAGGGATGCAGGG - Exonic
1069292633 10:66800837-66800859 ATGCTAGCAAGTAGGATGAATGG - Intronic
1070528834 10:77318510-77318532 ATACTAGAAGGTAGGATGATAGG - Intronic
1071787271 10:88915854-88915876 AAAGGAGGAGGTTGGATGGAGGG + Intronic
1072545474 10:96433507-96433529 ACACAAGGAGGTTCGATGGAAGG + Intronic
1073568809 10:104558514-104558536 CTACTAGGAGGTGGTTTGGAAGG + Intergenic
1073945768 10:108748095-108748117 AGTGTAGGAAGTAGGATGGAAGG + Intergenic
1075423815 10:122326541-122326563 ATACTCGCAGGAAGGGTGGAAGG + Intronic
1076303173 10:129443223-129443245 ATGCTAGATGGAAGGATGGAAGG - Intergenic
1076427888 10:130380509-130380531 CTCCTAGGAGACAGGATGGATGG + Intergenic
1077703582 11:4463218-4463240 ATAGCTGGAGGTTGGATGGATGG - Intergenic
1078908436 11:15708858-15708880 ACAGTAGCAGATAGGATGGAAGG - Intergenic
1079307413 11:19335520-19335542 CTACTAGAAAGTAGGATGCATGG - Intergenic
1079525742 11:21385530-21385552 ATACTAGGAGGTAGGATGGAGGG - Intronic
1081056792 11:38419390-38419412 AAACTAGTAAATAGGATGGAAGG - Intergenic
1081765820 11:45609454-45609476 ATACTTGGATGATGGATGGATGG + Intergenic
1082832618 11:57630245-57630267 TTACTAGGAGGTAGGATCACTGG - Intergenic
1085136054 11:74089692-74089714 ATGCTAGGAGGTTAGAAGGATGG + Intronic
1086508085 11:87527123-87527145 ATACGGTGAGGTATGATGGAAGG - Intergenic
1087047027 11:93850814-93850836 ATGCTAGGTGGCAGGAAGGAGGG + Intergenic
1087969765 11:104465284-104465306 AAATTAGGAGGGAGGAGGGAGGG - Intergenic
1088488041 11:110359866-110359888 AAAGTAGGAGGGAGGAGGGAAGG - Intergenic
1088711149 11:112509922-112509944 ATGGAAGGAGGAAGGATGGAAGG - Intergenic
1088883704 11:113991136-113991158 ACACTAGGAGGTGGGATTTAAGG + Intergenic
1089139519 11:116274720-116274742 AAACTAGGAGGGAGAAAGGAAGG + Intergenic
1089595549 11:119577001-119577023 GAACTAGCAGGTAGGGTGGAGGG + Intergenic
1089841575 11:121423359-121423381 ATACTCGGAGGTGGGATTGCTGG + Intergenic
1091177875 11:133578241-133578263 ATACTCAGAGGTAGGATTGTTGG - Intergenic
1091291191 11:134440706-134440728 ATATTGGAAGGAAGGATGGATGG - Intergenic
1092458261 12:8664243-8664265 ATAAAAGGGGGTATGATGGAAGG + Intergenic
1094054097 12:26251038-26251060 ATGTTAGGAGGAAGGAAGGAAGG - Intronic
1095924956 12:47569325-47569347 TTAGTTCGAGGTAGGATGGATGG - Intergenic
1096025422 12:48356800-48356822 GTACTAGAAGGTAGGAAAGAAGG - Intergenic
1097218730 12:57434315-57434337 ACCCCAGGAGGGAGGATGGAGGG + Intergenic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1097316346 12:58174870-58174892 ATAATAGGAGGTAGCAGGGAAGG + Intergenic
1097591931 12:61585253-61585275 ATACCAGGAGGTAGGATGTAGGG + Intergenic
1100184794 12:92127650-92127672 AGAAGAGGAGGGAGGATGGAAGG + Intronic
1100914323 12:99401707-99401729 AAACGAGGTGGGAGGATGGATGG + Intronic
1103956800 12:124581968-124581990 GTAGAAGGAGGTAGGAGGGAGGG + Intergenic
1105212320 13:18264434-18264456 AGAGTAGGAGCTAGGATGGCAGG - Intergenic
1106057234 13:26249953-26249975 ATTGTAGGAGGCAAGATGGATGG - Intergenic
1106313487 13:28574216-28574238 ATGCTTGGAGGTAGGAAGAAAGG - Intergenic
1106435296 13:29718231-29718253 TTACTAGGAGATAGGCTGGGAGG - Intergenic
1107784435 13:43940755-43940777 ATATTTGGAGGAAGGAAGGAAGG - Intergenic
1107824552 13:44316535-44316557 ACACTAGGAGGTAGGAAAGAAGG + Intergenic
1108845249 13:54670477-54670499 ATCCTAGGAGGCAGGAGGGGTGG - Intergenic
1110832553 13:80047786-80047808 TTAAGAGGAGGTAGGATGGGTGG + Intergenic
1112749318 13:102566072-102566094 TTACTAGGAGCTAGGATGGAAGG + Intergenic
1112865175 13:103886481-103886503 ATAGTAAGAGATAGTATGGAAGG + Intergenic
1115128742 14:30027259-30027281 CTACTGGGAGGTAGGGTGCAGGG - Intronic
1115723757 14:36190763-36190785 GTAATAGGTGCTAGGATGGAGGG + Intergenic
1118185320 14:63532231-63532253 AAACTAGGAGAAGGGATGGAAGG + Intronic
1118567999 14:67163899-67163921 ATCATAGGAGGTGGGGTGGAAGG - Intronic
1119706613 14:76786907-76786929 ATACTAGGAGGAGGCATGGGGGG + Intergenic
1122360331 14:101156239-101156261 ATAGCAGGGGGTAGGAGGGAGGG - Intergenic
1122969097 14:105145230-105145252 ATACCAGGAGGCAGGAGTGACGG + Intronic
1125478284 15:40062502-40062524 ATACTAGAAGGGATGGTGGATGG + Intergenic
1126680878 15:51201103-51201125 ATAATAGGAGGTAGGGTGGCAGG + Intergenic
1126833329 15:52633176-52633198 CTACTAGGTGATAGGCTGGAGGG + Intronic
1131967481 15:97859539-97859561 CTACTAGATGGCAGGATGGAAGG - Intergenic
1135869743 16:26138339-26138361 ATAAAAGGAGGTAGGAGGGAGGG - Intergenic
1137690447 16:50423182-50423204 AGACTAGCTGGTAGGCTGGAGGG + Intergenic
1138124394 16:54426855-54426877 ATACTAGGAGCTAGCTAGGAGGG + Intergenic
1138263846 16:55645240-55645262 GAACTAGGAGGTAGGGTGCAGGG - Intergenic
1138631138 16:58295100-58295122 TTACGAGGAGCTAGGATGAAAGG + Intronic
1138722157 16:59094890-59094912 ACACAAGGAGGGAGGAAGGAAGG + Intergenic
1139477235 16:67208792-67208814 ATCCTAGGAGGGAGGAAGGGAGG + Intronic
1140748378 16:78000966-78000988 ATACTAGGGGGTGGGAGGGCAGG + Intergenic
1141633300 16:85300888-85300910 ATTCTGGGAGGCAGGATGGCTGG - Intergenic
1144122422 17:12167991-12168013 ATACTGTGAGGAAGGAAGGAAGG - Intergenic
1146031379 17:29369050-29369072 ATACAAGGTGGCAGGATTGAGGG - Intergenic
1147229127 17:39004354-39004376 AGACAAGGAGGGAGGAGGGAGGG - Intergenic
1150184600 17:63166981-63167003 ATACAAGAAGGAAGGAAGGAAGG + Intronic
1150352666 17:64458119-64458141 ATACAAGAAGGAAGGAAGGAAGG - Intronic
1152378924 17:79932169-79932191 GTTCTAGGAGGCAGAATGGATGG + Intergenic
1153327234 18:3833225-3833247 AAACAAGGAGGAAGGAAGGAAGG - Intronic
1153459578 18:5318806-5318828 AGACTGGGTGGTAGGATGGAGGG - Intergenic
1153951715 18:10063074-10063096 AATGTAGGAGGAAGGATGGAAGG - Intergenic
1155882090 18:31162434-31162456 AGACTAGGAGTGAGGATGGGAGG - Intronic
1156259852 18:35436297-35436319 ATACTAGGGGGTGGAGTGGAGGG - Intergenic
1157602188 18:48901162-48901184 ATATTTGTAGCTAGGATGGAAGG + Intergenic
1158258831 18:55586555-55586577 TAACTAGGAGGTAAGATGTAAGG + Intronic
1158970779 18:62664319-62664341 AGACTGGGAGGTGGGATGCAGGG + Intergenic
1165403213 19:35614874-35614896 ATCCTAGGAGGAAGGAGGGAGGG + Intronic
1166894786 19:46016533-46016555 AGACGAGGAGGTAGGACGGACGG - Intronic
1167998701 19:53427210-53427232 ATACTCAGAGGTAGGATTGCTGG + Intronic
1168008826 19:53513321-53513343 ATACTCAGAGGTAGGATTGCTGG + Intergenic
925831603 2:7901643-7901665 TTGCTAGGATGTAGGAGGGATGG - Intergenic
926329024 2:11809823-11809845 ATGATAAGAGATAGGATGGAAGG + Intronic
926951272 2:18246050-18246072 ATACATGGCAGTAGGATGGAAGG - Intronic
926965387 2:18404209-18404231 GTAGTGGGAGGTAGGATGGAGGG + Intergenic
932688932 2:73896225-73896247 ATCCTAGGAGCTGGGATGGCAGG - Intronic
933370057 2:81403294-81403316 AGACCTGGAGGTAGAATGGATGG + Intergenic
933979541 2:87538974-87538996 ATACTATGAGTTAGGAGGGAAGG - Intergenic
934301302 2:91777967-91777989 AGAGTAGGAGCTAGGATGGCAGG + Intergenic
934658488 2:96130396-96130418 ATGCAAGGAGGAAGGATGGGTGG - Intronic
936166436 2:110124141-110124163 CACCTAAGAGGTAGGATGGAGGG + Intronic
936229181 2:110685020-110685042 AGACTGGGAGGAAAGATGGAGGG + Intergenic
936314268 2:111411752-111411774 ATACCAGGGGTTAGGAGGGAAGG + Intergenic
936314281 2:111411817-111411839 ATACTATGAGTTAGGAGGGAAGG + Intergenic
936518933 2:113199616-113199638 ATATTAATAGGTAGTATGGATGG + Intronic
938001533 2:127743791-127743813 AAACGAGGAGGTAGGAGGCATGG + Intronic
938009548 2:127818005-127818027 CTACTGGGAGGTAGAATGGGTGG - Intergenic
938215234 2:129506291-129506313 ATAGTATGGGGAAGGATGGATGG - Intergenic
938941633 2:136174823-136174845 ACAATAGGAGGAAGGAAGGAAGG + Intergenic
939883486 2:147656172-147656194 ATACTAGGAGCTTGGAGTGAGGG + Intergenic
941592320 2:167435486-167435508 ATACTGGGAGTTAGGATGCGAGG + Intergenic
943662924 2:190578334-190578356 AGGCTAAGAGGGAGGATGGAAGG - Intergenic
944324741 2:198391006-198391028 AAATTAGGAGGTAGGAGTGAAGG + Intronic
947187771 2:227470644-227470666 ATAATAGGAGAGGGGATGGAGGG + Intergenic
947710772 2:232314233-232314255 GTGCTGGGAGGTAGGATTGAAGG + Intronic
947991214 2:234489088-234489110 ATACTGAGAGGTAGGCAGGATGG + Intergenic
948882782 2:240868953-240868975 ATGCGAGGAGGCAGGTTGGAAGG - Exonic
1170405585 20:16032574-16032596 AAACTAGGATGCAGGAAGGAAGG + Intronic
1174182572 20:48684125-48684147 ATTCTAGGAGGCGGGAAGGAAGG - Intronic
1175020417 20:55841965-55841987 ATACCAGGAAGTAGGATTGCTGG - Intergenic
1177377152 21:20285918-20285940 CTACTAGAAGTTAGGATGCATGG + Intergenic
1179567386 21:42257907-42257929 AAAATGGGAGGAAGGATGGATGG - Intronic
1180815138 22:18784753-18784775 AGAGTAGGAGCTAGGATGGCAGG - Intergenic
1181201328 22:21219090-21219112 AGAGTAGGAGCTAGGATGGCAGG - Intronic
1181700421 22:24617873-24617895 AGAGTAGGAGCTAGGATGGCAGG + Intronic
1181824893 22:25507145-25507167 ATAAAAGGATGGAGGATGGATGG - Intergenic
1182680728 22:32077415-32077437 AGAGTAGGGGGAAGGATGGAGGG - Intronic
1183141917 22:35950448-35950470 ATTGTAGGAGCTAGGATGGAGGG - Intronic
1184664819 22:45982700-45982722 ATACTGGGAGGATGGATGGATGG + Intergenic
1203225586 22_KI270731v1_random:76340-76362 AGAGTAGGAGCTAGGATGGCAGG + Intergenic
1203265244 22_KI270734v1_random:10444-10466 AGAGTAGGAGCTAGGATGGCAGG - Intergenic
951086902 3:18522147-18522169 ATACTTGGAAGTAGGTTGCATGG + Intergenic
951774370 3:26292897-26292919 TTTCCAGGAGGTAGGATTGACGG + Intergenic
951896164 3:27611881-27611903 ATGCAAGGAGGAAGGAAGGAAGG - Intergenic
951958884 3:28292126-28292148 ATTCTAGGAGCTAGGATCCATGG + Intronic
952057378 3:29464235-29464257 AGACTGGGAGGTAGGAGGCAAGG + Intronic
954278964 3:49562160-49562182 ACAGTAGGAGGTAGAAGGGAAGG - Intronic
957175557 3:76803426-76803448 AAAAGAGGAGGAAGGATGGAGGG + Intronic
958963038 3:100528512-100528534 AGAGGAGGAGGCAGGATGGAAGG + Intronic
959400883 3:105900812-105900834 AGACTGGGTGGCAGGATGGAAGG + Intergenic
959800160 3:110484275-110484297 ATAATAGAAGGAAGGAAGGAAGG + Intergenic
962480989 3:135798484-135798506 ATATATGGGGGTAGGATGGAAGG + Intergenic
963845073 3:150147306-150147328 TGACTAGAGGGTAGGATGGAAGG + Intergenic
964435331 3:156645428-156645450 ATTCTAAGAGGTAGGATCAAAGG + Intergenic
964553221 3:157908392-157908414 GAAATAGGAGGTAGGATGTAGGG - Intergenic
966003107 3:174974587-174974609 ATTCTAGGAGCCAGAATGGAAGG - Intronic
966668710 3:182502305-182502327 AACTTAGCAGGTAGGATGGAAGG + Intergenic
967141652 3:186566920-186566942 ATTCTCGGAGTTAGAATGGAGGG - Intronic
967759964 3:193212684-193212706 ATACTAGGGGGTGGAATGGCTGG + Intergenic
968591241 4:1460631-1460653 AAACAAGGAGGGAGGAGGGAAGG - Intergenic
969881732 4:10179975-10179997 ATACTAGAAGAAAGCATGGAAGG + Intergenic
969906674 4:10403535-10403557 ATAATGGGAGGTAGGGCGGAAGG + Intergenic
970836986 4:20421065-20421087 GTACCTGGAGGTAGAATGGAGGG + Intronic
973375542 4:49284301-49284323 GTAATAGGAGGAAGGAAGGAAGG + Intergenic
973381869 4:49325940-49325962 GTAATAGGAGGAAGGAAGGAAGG - Intergenic
974554002 4:63419677-63419699 ATATTAGGAGGTAGGATCTTTGG - Intergenic
976280244 4:83320176-83320198 ATCATGGGAGGTAGGATGGGTGG + Intronic
976759187 4:88529959-88529981 ATATTAGGAGGTGGAAAGGAGGG + Intronic
978033076 4:103959649-103959671 ATACTAGGGGTGAGGAAGGAGGG + Intergenic
978938487 4:114409170-114409192 ATACAAAGAGAGAGGATGGATGG - Intergenic
981675584 4:147339406-147339428 AGACCAGGAGGTAGGATCAAAGG + Intergenic
982448213 4:155519898-155519920 GAACTACGTGGTAGGATGGAGGG + Intergenic
983391270 4:167133213-167133235 ATTTTAGGAGGAAGGCTGGAGGG + Intronic
985337938 4:188915967-188915989 TTAATTGGAGGCAGGATGGATGG - Intergenic
986361183 5:6979745-6979767 AAACTAGGAGGCAGGAATGAGGG - Intergenic
988816928 5:34843306-34843328 AGAATAGGAGGTTGAATGGAAGG - Intronic
989113918 5:37933332-37933354 ATACTGGGAGATGGGAGGGATGG + Intergenic
990390843 5:55318610-55318632 CTACTTGGAGGGAGGGTGGAAGG + Intronic
991098720 5:62767938-62767960 GTATTAGGAGGTAGGATCCATGG + Intergenic
992126248 5:73645058-73645080 ATTCTGGGAGGTAGGAAGGTAGG + Intronic
992167231 5:74066663-74066685 AAACTGGGAGGGAGGAAGGATGG - Intergenic
992793482 5:80234666-80234688 ATAATAGGAGGTTGGAGGGTAGG - Intronic
993071412 5:83168518-83168540 ATAATGGAAGGAAGGATGGATGG + Intronic
993880428 5:93354165-93354187 ATACTAGAAGGAAGAGTGGAGGG - Intergenic
996132569 5:119799313-119799335 ATACTAGGAGAAAGGATGCTGGG + Intergenic
998487207 5:142513123-142513145 ACACTGGGGGGTAGGATGGGGGG - Intergenic
998569861 5:143247453-143247475 ATAGTAGGTGGGTGGATGGATGG + Intergenic
999375237 5:151081780-151081802 ATATAAGTAGGTAGGGTGGAAGG - Intronic
999421681 5:151449931-151449953 TTACTAGCATGTGGGATGGATGG + Intronic
999421686 5:151449970-151449992 TTACTAGCATGTGGGATGGATGG + Intronic
999421716 5:151450222-151450244 TTACTAGCATGTGGGATGGATGG + Intronic
999421721 5:151450258-151450280 TTACTAGCATGTGGGATGGATGG + Intronic
999421726 5:151450294-151450316 TTACTAGCATGTGGGATGGACGG + Intronic
999421733 5:151450330-151450352 TTACTAGCATGTGGGATGGACGG + Intronic
999421740 5:151450366-151450388 TTACTAGCATGTGGGATGGATGG + Intronic
999421754 5:151450474-151450496 TTACTAGCATGTGGGATGGACGG + Intronic
999421766 5:151450547-151450569 TTACTAGCATGTGGGATGGATGG + Intronic
999422283 5:151455192-151455214 TTACTAGCATGTGGGATGGATGG + Intronic
1005713947 6:28529121-28529143 ATACTAGGAGGGTGGAAGGGAGG - Intronic
1006425388 6:33960005-33960027 ATGCTGGGAGGGAGGAGGGATGG - Intergenic
1008039378 6:46780193-46780215 ACTCTAGGAGGAAGGATGGGAGG + Intergenic
1009581394 6:65538741-65538763 ATACTAGGAGGAGTCATGGAAGG - Intronic
1012601724 6:101106555-101106577 ATACTAGGAGTGAGGAAGGTGGG + Intergenic
1013874944 6:114813675-114813697 ATACTAAGAGGTAGAATTGAGGG - Intergenic
1017062006 6:150492847-150492869 CCACAAGGAGGGAGGATGGAAGG - Intergenic
1021907747 7:25352434-25352456 ACACTAGGAAGTAGCAAGGAGGG + Intergenic
1022007619 7:26280726-26280748 ATACTAAGAGGTAGTATTGCCGG + Intergenic
1022389813 7:29933716-29933738 ATAGTAGGAGGAGGGAGGGAGGG + Intronic
1022625244 7:32029324-32029346 ATACTAGGAAGTAGGATTGCTGG - Intronic
1022691667 7:32662271-32662293 ATACTAGGAGGCAGAATTGTAGG - Intergenic
1022919281 7:34996495-34996517 ATACTAGGAGGGAGGCTCCAGGG - Intronic
1024422018 7:49179256-49179278 AAACAAGAAGGTAAGATGGAAGG - Intergenic
1026580540 7:71612775-71612797 AAACTAGGAGCTTGGATGAAAGG - Intronic
1028923279 7:96330099-96330121 ATACTAGAAGGTTAGCTGGAAGG - Intergenic
1030627363 7:111858826-111858848 ATACATGGAGGAAGGAAGGAAGG - Intronic
1030724700 7:112913175-112913197 ATAATAGGAGATGGGATGGTTGG - Intronic
1030802698 7:113871870-113871892 TTACTAGGAGTTTGAATGGATGG + Intergenic
1032787031 7:135209007-135209029 ACACAAGGAGGTAGCAAGGAGGG + Intronic
1033717811 7:144021072-144021094 CTACAATGAGATAGGATGGAGGG - Intergenic
1034244307 7:149633071-149633093 ATACTAGATGGTAAGATGCAGGG + Intergenic
1042166891 8:65954484-65954506 ATACTAGGAGGTAGGACTTTTGG + Intergenic
1042516700 8:69666245-69666267 ATACTAGGAGACAGGAGGAAGGG + Intergenic
1043143829 8:76625447-76625469 ATACTAGGAGGTAGGGGTAATGG - Intergenic
1043261859 8:78210381-78210403 AAACTAGGAGGTATGCTGAAAGG - Intergenic
1043350549 8:79355338-79355360 ACACCAGGAGGGAGGAGGGATGG + Intergenic
1043413279 8:80022099-80022121 TTACTAGGAGTTAGGAAGGAGGG - Intronic
1046897004 8:119483912-119483934 TTTCTAGGAGGTATGATGCAGGG - Intergenic
1047863006 8:128989631-128989653 AAACTTGGAGGAAGCATGGAGGG - Intergenic
1047928597 8:129704401-129704423 AGAGAAGGAGGTAGGAAGGAGGG - Intergenic
1048565237 8:135589139-135589161 ATACTGGTAGTTTGGATGGATGG + Intronic
1049993006 9:1007647-1007669 ATACTAGGAAGAAGGAAGAAGGG + Intergenic
1051216485 9:14803368-14803390 AGACTATGAGGAAGGAAGGAAGG - Intronic
1052722000 9:32183121-32183143 GGACCAGGTGGTAGGATGGATGG + Intergenic
1052841274 9:33292977-33292999 ATTCTAGGGGATGGGATGGAGGG - Intronic
1055681103 9:78716387-78716409 ATACTTGGAGAGAGGTTGGAGGG + Intergenic
1057042056 9:91855250-91855272 TTGCTAGGAGTGAGGATGGATGG - Intronic
1057186863 9:93061982-93062004 ATCCCAGGAGGGAGGATGGAGGG + Intronic
1057878858 9:98778144-98778166 AACCCAGGAGGTAGGATGAAGGG + Intronic
1058302274 9:103390829-103390851 AAACTTGGAGGAAGGAAGGAGGG + Intergenic
1059174406 9:112155934-112155956 AGAGAAGGAGGAAGGATGGAAGG + Intronic
1061036762 9:128118567-128118589 ATGCTGGGATGGAGGATGGAGGG + Intergenic
1186053612 X:5626519-5626541 ATGTTGGGAGGTAGGAAGGAGGG + Intergenic
1186713954 X:12230609-12230631 ATACCAGGTGGTAGGAGGTATGG + Intronic
1189736726 X:44078893-44078915 TTACCAGGGGTTAGGATGGAAGG + Intergenic
1190427544 X:50346928-50346950 AACCTAGGAGATTGGATGGAAGG - Intronic
1190901380 X:54677062-54677084 ATTGGAGGAGGGAGGATGGAAGG + Intergenic
1191604250 X:63044099-63044121 ATACTAGGGGGTAGGTTGTAGGG + Intergenic
1193165884 X:78279941-78279963 ACCATAGGAGGTAGGGTGGAAGG + Intronic
1193236833 X:79116957-79116979 TCACAAGGAGGCAGGATGGAGGG + Intergenic
1195090682 X:101455809-101455831 ATACTAGACGGGAGGCTGGAGGG - Intronic
1195533551 X:105984386-105984408 ATTCCAGGAAGTAGGATAGAGGG - Intergenic
1196657563 X:118234957-118234979 AAACTAGGAGGAAGCAAGGAAGG - Intergenic
1197693818 X:129529655-129529677 ATAGTAAGAGGTAGGAGGGAAGG + Intergenic
1198148760 X:133886958-133886980 ATACTCGGAAGTAGGATTGGTGG + Intronic
1198930977 X:141859952-141859974 AAACTAAGTGGTAGGAGGGAAGG - Intronic
1200403790 Y:2787757-2787779 GTACTAGGGGGTAGGCTGGTTGG - Intergenic
1200908547 Y:8510983-8511005 ATGGAAGGAGGAAGGATGGAAGG - Intergenic