ID: 1079525830

View in Genome Browser
Species Human (GRCh38)
Location 11:21386447-21386469
Sequence CTTTGTCTATGGAAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079525830_1079525835 18 Left 1079525830 11:21386447-21386469 CCCACTTCCTTCCATAGACAAAG 0: 1
1: 0
2: 3
3: 22
4: 273
Right 1079525835 11:21386488-21386510 CATTCCTGATCAGATAAGCATGG 0: 1
1: 0
2: 1
3: 4
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079525830 Original CRISPR CTTTGTCTATGGAAGGAAGT GGG (reversed) Intronic
901423889 1:9168969-9168991 CCCTGTGGATGGAAGGAAGTAGG - Intergenic
903194303 1:21673419-21673441 CGTTCTCTCTGAAAGGAAGTGGG - Intergenic
904136846 1:28319379-28319401 GCTTGTCTAGGGCAGGAAGTAGG - Intergenic
907853703 1:58280972-58280994 CTTTGTACATGGATGGAGGTTGG + Intronic
908222387 1:62020481-62020503 CTTTCTTTATGGAAGGAGGAGGG - Intronic
908433768 1:64084743-64084765 CTTTGTCTGTTGAAGGAGTTTGG - Intronic
908875220 1:68666527-68666549 CTTTTTCTATGAAATGGAGTTGG + Intergenic
908916403 1:69131177-69131199 CTTGGTCAGTGGAAGGCAGTAGG + Intergenic
909901647 1:81144401-81144423 TTTTGTCTTTGGAAGTAAGTAGG - Intergenic
910464119 1:87478270-87478292 CTCTGCCTTTGGAAGGAAGGAGG - Intergenic
912703908 1:111897954-111897976 CCGTGTTTATGGAAGGAAGGTGG - Intronic
917772426 1:178294293-178294315 GTTTGTGTATGGAAGTATGTGGG - Intronic
918072501 1:181143164-181143186 CTTTGTTTATGGGATGAACTGGG + Intergenic
918778338 1:188666539-188666561 CTTTTATTAGGGAAGGAAGTTGG - Intergenic
918978316 1:191520690-191520712 CTTTCTCTCTAGAAGGAAGAAGG - Intergenic
922918791 1:229283144-229283166 ATGTGTCAATGGAAGCAAGTGGG - Intronic
923539220 1:234876162-234876184 CACTGTCTCTGGAAGGAAGTGGG + Intergenic
924929863 1:248720830-248720852 TTTTGTATATGGTAAGAAGTAGG - Intronic
1063137624 10:3231137-3231159 CAGTGTCTATGGAATGAAATGGG - Intergenic
1063977490 10:11429059-11429081 CTTTGTCTGTGGAAGGCAATAGG - Intergenic
1066054227 10:31665485-31665507 TTTTTTCTATTGAAGGAAGAGGG + Intergenic
1066676660 10:37894744-37894766 GTATTTTTATGGAAGGAAGTTGG - Intergenic
1068420833 10:56790142-56790164 CTTTGTTTATCCAAGGAAATGGG - Intergenic
1068693056 10:59937946-59937968 CTAGGTCTATGCAAGGAACTGGG - Intergenic
1069066890 10:63950942-63950964 TTTTGTCTATGGCATGAGGTAGG + Intergenic
1069149261 10:64935122-64935144 CTTTGTTTATGTGAGGAGGTGGG + Intergenic
1069248862 10:66244159-66244181 CTCTGCCTATGGAAAGAGGTAGG + Intronic
1069315263 10:67091442-67091464 CTTTGTCTTTGGAAAGAAGTGGG - Intronic
1069694569 10:70377077-70377099 CCTTGTGCATGGCAGGAAGTGGG + Intronic
1071327540 10:84531989-84532011 TTTTGTGTATGGAATGAGGTGGG + Intergenic
1071845627 10:89518446-89518468 ATTTGTACATGCAAGGAAGTTGG + Intronic
1072310490 10:94149713-94149735 CTTTCTCTATGGAAGGGAATTGG - Intronic
1072702708 10:97655437-97655459 GTTTGTCTCTGGAAAGAAGATGG + Intronic
1074413602 10:113248123-113248145 CTGTGACTATGGGAGTAAGTTGG + Intergenic
1074705850 10:116130751-116130773 TTTTGTGTATGGTATGAAGTAGG - Intronic
1076102065 10:127790513-127790535 CATTTTCTTTGCAAGGAAGTAGG + Intergenic
1077427487 11:2490180-2490202 CTTTGCCTATGGAAAGGAGAAGG + Intronic
1077833220 11:5898611-5898633 TTTTGTATATGGTAAGAAGTAGG + Intronic
1077862216 11:6192337-6192359 CATTGTCTAGGGAAGGGAGGGGG + Intergenic
1078184100 11:9036979-9037001 CTTTCTCTCTGGAAGGAAAATGG - Intronic
1078389803 11:10927196-10927218 CTTTGTATATGGAAGCAAACAGG - Intergenic
1079051443 11:17163992-17164014 CTTTATCTATGAAATAAAGTTGG - Intronic
1079525830 11:21386447-21386469 CTTTGTCTATGGAAGGAAGTGGG - Intronic
1082624919 11:55472042-55472064 CTTTTACTAAGGAAAGAAGTGGG + Intergenic
1082874628 11:57975419-57975441 CTTTTTCTAAAAAAGGAAGTGGG - Intergenic
1084925959 11:72511401-72511423 CTTTGAGAATGGATGGAAGTAGG - Intergenic
1085272206 11:75277085-75277107 CTTTGGTTATGGAAGGAAATGGG - Intronic
1085359052 11:75869177-75869199 CTTAATCAGTGGAAGGAAGTGGG - Intronic
1085709361 11:78815068-78815090 CTTTGTCTCTGGAAAGGACTTGG - Intronic
1087022823 11:93620521-93620543 TTTTGTGTATGGTATGAAGTAGG + Intergenic
1087748998 11:101985193-101985215 TTTTGTCCATGAAATGAAGTTGG - Intronic
1088580383 11:111310118-111310140 CTTTGTGTATATGAGGAAGTTGG - Intergenic
1089043084 11:115472321-115472343 ATTTGCCTTTGGAAGAAAGTTGG + Intronic
1089349981 11:117816700-117816722 CTGCGTCTAGTGAAGGAAGTGGG - Intronic
1089546348 11:119229129-119229151 GTTAGTCTGTGGAAGGAAGTGGG - Intronic
1090717014 11:129439826-129439848 CTTTGTCTATGGTAGCACGGTGG + Intronic
1090922177 11:131216044-131216066 ATCTGTCTCTGAAAGGAAGTGGG + Intergenic
1090925599 11:131247363-131247385 CTTTGTCAACAGAAGGAAGAAGG - Intergenic
1091068211 11:132537405-132537427 TTTTGTATATGGTATGAAGTAGG - Intronic
1095173217 12:39059722-39059744 GTTTGTTTATGGAAAGAAGCAGG - Intergenic
1097291862 12:57923754-57923776 TTTTGTCTATGGCATGAGGTAGG - Intergenic
1099121605 12:78696399-78696421 CTTTGTCTCTGGAAGTAATTTGG - Intergenic
1100343404 12:93703174-93703196 CTTTATCTAAGAAAGAAAGTAGG + Intronic
1104047225 12:125171955-125171977 CTCTGCCTACGGAAGAAAGTAGG + Intergenic
1104324101 12:127779675-127779697 AATTGTTAATGGAAGGAAGTAGG + Intergenic
1105724702 13:23150704-23150726 TTTTGTGTATGGTAGGAAGAAGG + Intergenic
1106279236 13:28249305-28249327 TTTTGTATATGGTATGAAGTAGG + Intronic
1106341610 13:28834505-28834527 TTTTGTATATGGTATGAAGTAGG - Intronic
1106738561 13:32613907-32613929 TTTTGTATATGGTATGAAGTAGG + Intronic
1109446238 13:62445050-62445072 CTTAGTCTGTGGAAGGAACCTGG + Intergenic
1109755005 13:66746036-66746058 ATATGTCTATGGGGGGAAGTGGG - Intronic
1111905994 13:94256766-94256788 CTCTGTCTCTGGAAGGATTTGGG - Intronic
1112924048 13:104651194-104651216 CTTAGTCTATGGAACCAACTTGG + Intergenic
1113353734 13:109556347-109556369 CATTGTCCATGGTAGAAAGTGGG - Intergenic
1114852274 14:26395326-26395348 CTTCCTCTGTGGAAAGAAGTTGG - Intergenic
1118970582 14:70633761-70633783 CCTTGTATATGGAAGTCAGTGGG + Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120492818 14:85198165-85198187 CTTTGACTATGAAGGGAAGCCGG + Intergenic
1121373668 14:93384852-93384874 TTTTGTGTATGGTAAGAAGTAGG + Intronic
1121759712 14:96434828-96434850 CTCTGTCTTTGGAAAGAAGAGGG - Intronic
1121917041 14:97844709-97844731 CTTTGTAAAAGGAAGGAAGGAGG + Intergenic
1122722416 14:103729776-103729798 CTTTTTCTATGGCAAGAAGGTGG - Exonic
1123103381 14:105821093-105821115 TTTTCTCCATGGAAGAAAGTTGG + Intergenic
1123508587 15:20972089-20972111 CTCTGCCTGTGGAAGGAAGAGGG - Intergenic
1124460266 15:29883528-29883550 GTTTGTGTGTGGAAGGAGGTAGG - Intronic
1125511312 15:40293945-40293967 CTTTGGCTAGGGAGGGAGGTGGG - Intronic
1126386743 15:48100999-48101021 CTTTGTTTATGGAAGAAAAAAGG - Intergenic
1126857563 15:52853754-52853776 GTATGTCTGTGGAAGGAAGAGGG + Intergenic
1127807375 15:62533759-62533781 CTTTGGCTAAGGAGAGAAGTTGG + Intronic
1128197073 15:65768002-65768024 ATTTCTCTCTGGAAGGAAGTGGG - Intronic
1128986624 15:72226800-72226822 CTTTGTCTATGGACAGAAGTGGG + Intronic
1129935220 15:79442236-79442258 TTTTGTCAATGGCAAGAAGTGGG + Intronic
1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG + Intronic
1130079721 15:80721940-80721962 CTTTGTGTTGGGAAGGGAGTTGG + Intronic
1131115063 15:89790406-89790428 CTTTGGCCTGGGAAGGAAGTAGG + Intronic
1132910225 16:2306484-2306506 CTGGGTCTGTGGAAGGAGGTGGG - Intronic
1133317317 16:4892755-4892777 CTTTGTATAGGAAAGGAGGTGGG + Intronic
1133884251 16:9810861-9810883 ATTTCTCTATGGGAGGAAGGAGG + Intronic
1134844093 16:17425228-17425250 ATCTGGCTACGGAAGGAAGTTGG - Intronic
1137852838 16:51763372-51763394 CTTTGTGTATGGAAGGGACTAGG + Intergenic
1138156691 16:54712262-54712284 CTTCATCTATAGAAGGAAGGAGG - Intergenic
1139631290 16:68233491-68233513 ATGTGTCTATGGAGGGGAGTTGG - Intronic
1140619732 16:76715976-76715998 CTATATCTATTTAAGGAAGTAGG + Intergenic
1141005878 16:80351014-80351036 CTTTGTCTATGGAAGCTCATGGG + Intergenic
1141732788 16:85833997-85834019 CTGTGTCAAAGGAAGGAAGGAGG + Intergenic
1144666742 17:17107279-17107301 CTTTGTCACTGGGAGGAATTGGG - Intronic
1146206232 17:30907516-30907538 GTTTGTGTCTGGAAGGCAGTGGG + Intronic
1146489204 17:33268048-33268070 CTTTGACTTTTGAAGGCAGTTGG + Intronic
1146579830 17:34027195-34027217 CTTTGCCAGTGGAAGGAACTTGG - Intronic
1147343833 17:39773286-39773308 CTTTTACCATGGAAGGAAGGAGG - Intronic
1151194186 17:72420302-72420324 CCTAGTCTATGGGAGGAATTGGG - Intergenic
1151775285 17:76197074-76197096 TGTTGTCTATGGATGGAATTTGG + Intronic
1153484327 18:5581463-5581485 TTTTGTTTATGTAAGTAAGTAGG + Intronic
1153504601 18:5783146-5783168 ATTTGTCTTTGGTAGGAATTGGG - Intergenic
1155642561 18:28037004-28037026 CTTTCTCTAAAGAAGGAACTTGG + Intronic
1156029735 18:32698583-32698605 CTTTTTAAATGGAGGGAAGTGGG - Intronic
1156256922 18:35407398-35407420 TTTTGTGTATGGTATGAAGTAGG - Intergenic
1156445558 18:37234015-37234037 CATTGTCTGAGGAAGGAAGCAGG + Intergenic
1156572280 18:38270347-38270369 TTTTGTGTATAGAAAGAAGTAGG + Intergenic
1157653454 18:49361203-49361225 CATTGCCTAGGGAAGGAAATGGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158254127 18:55526583-55526605 CTTTGTCTATGGAAGGCTCAAGG + Intronic
1158820502 18:61153326-61153348 CTTTTCTTATGGAAAGAAGTGGG + Intergenic
1159263145 18:66042634-66042656 CCTCTTCTATGGAAGGGAGTAGG - Intergenic
1160009264 18:75091317-75091339 TTTTGTGTATGGTACGAAGTGGG + Intergenic
1160376543 18:78418044-78418066 CTATGTTTCTTGAAGGAAGTTGG + Intergenic
1162619829 19:11833441-11833463 TCATGTCTATGAAAGGAAGTAGG - Exonic
1162629111 19:11912399-11912421 TCATGTCTATGAAAGGAAGTAGG - Intronic
1162744344 19:12790362-12790384 CTGTTTCTAAGGAAGGGAGTGGG + Intronic
1164456371 19:28410943-28410965 GTTTGTCTATGGAAAGAGATTGG - Intergenic
1166566949 19:43771162-43771184 CTGGGTCTATGGAGGGAAGGAGG + Intronic
1167248063 19:48385716-48385738 CTTGGTTTGTGGAAGGAAGGTGG + Intronic
1167249255 19:48391928-48391950 CTGGGTCTAGGGGAGGAAGTAGG - Intergenic
1167789589 19:51665348-51665370 CTTTGTGTATGGTATGAGGTAGG + Intergenic
926252333 2:11162195-11162217 CTGTGTCTATGGAGGGAGCTGGG + Intronic
926390785 2:12390429-12390451 TTTTGTCAAGGGAAGAAAGTGGG + Intergenic
927370096 2:22344592-22344614 CTTTGTCTAGGAAAGGAAGATGG - Intergenic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
929089967 2:38206008-38206030 TTTTGTGTATGGTAGGGAGTAGG - Intergenic
930086377 2:47500430-47500452 CTGAGTCGATGGAAGGAAGGAGG + Intronic
930886057 2:56328319-56328341 CTTTGTCTATTGAGGGAGGCTGG + Intronic
933784225 2:85825942-85825964 CTTTTTCCATTGAAAGAAGTTGG + Intergenic
936158457 2:110065630-110065652 TTTTGTATATGGAGTGAAGTAGG + Intergenic
936186204 2:110305692-110305714 TTTTGTATATGGAGTGAAGTAGG - Intergenic
936985386 2:118307401-118307423 ATTTGGCTTTGGAATGAAGTCGG + Intergenic
937159346 2:119745755-119745777 CTGGTTCTGTGGAAGGAAGTTGG - Intergenic
938046856 2:128129320-128129342 CTTTGTGTATGTAATAAAGTAGG + Intronic
939203456 2:139069238-139069260 CATTGTCTATGCAAGGAAAATGG - Intergenic
939575813 2:143893369-143893391 CTGTGTCTATGGAGACAAGTCGG - Intergenic
941423594 2:165315700-165315722 GTTTTTCCTTGGAAGGAAGTAGG + Exonic
941770532 2:169340581-169340603 CTTTCTCTATGCCAGGTAGTGGG - Intronic
942366199 2:175230423-175230445 TTTTGTCAATGGAAGGTAGGTGG + Intergenic
942882453 2:180877879-180877901 TTTTGTATATGGAAAGAAATAGG - Intergenic
942896837 2:181067280-181067302 TTTTCTCTTTGGAAGGAGGTAGG + Intronic
943790621 2:191928312-191928334 CTGTGGCTACAGAAGGAAGTTGG - Intergenic
944318174 2:198305831-198305853 CTTTGCCTATAGAATCAAGTTGG - Intronic
946086563 2:217179351-217179373 CTTTGAAGATGGAAGGAAGATGG + Intergenic
947004162 2:225491575-225491597 GTTTGTCTTTGGAAAGAACTTGG + Intronic
947063415 2:226192235-226192257 CTTTGACTTTGGATGGATGTGGG + Intergenic
947913744 2:233818954-233818976 CTTTGTCTCTGGCACGCAGTAGG + Intronic
1169513525 20:6291972-6291994 CTTTGTCTAAGTATGGCAGTTGG + Intergenic
1169666808 20:8046762-8046784 CTTTGTGAATGAAAGGAAGGAGG - Intergenic
1170345978 20:15387575-15387597 CTTCCTTTATGGAAGGAAGTGGG - Intronic
1170998811 20:21393178-21393200 TTTTGTATATGGAAGGATGGGGG - Intergenic
1171117860 20:22542144-22542166 CCTTGTCTGTGGGAGAAAGTTGG - Intergenic
1171157637 20:22890918-22890940 CTTTGTTTATGGAAGTCACTTGG - Intergenic
1171792636 20:29542315-29542337 GTTTGTATATAGAATGAAGTAGG - Intergenic
1171855831 20:30342086-30342108 GTTTGTATATAGAATGAAGTAGG + Intergenic
1173342195 20:42162565-42162587 CCATGTCTTTGGAAGGAGGTTGG - Intronic
1174765830 20:53253423-53253445 CTTAGTCTATGTGAGGAAATTGG + Intronic
1175716642 20:61259061-61259083 CTTTGTTTTAGGAAGGAAGAAGG + Intronic
1177559595 21:22732298-22732320 CTTGGTCTAGGGATGAAAGTGGG + Intergenic
1179915566 21:44475898-44475920 CCTTGGCTATGGGAGGAAGTGGG - Intergenic
1180111533 21:45657329-45657351 TTTTGTCTATGGTATGAAGGAGG + Intronic
1182074252 22:27484083-27484105 GTTTGGCTATGGAGGGAAGGAGG - Intergenic
1182668887 22:31979289-31979311 TTTTGTATATGGTATGAAGTAGG + Intergenic
1184775871 22:46622394-46622416 TTTTGAAAATGGAAGGAAGTAGG + Intronic
1184984025 22:48117265-48117287 ATTTGCCTATGGAAGGAAGAAGG + Intergenic
949204648 3:1423610-1423632 CTTTTTCTATGAAAGGGATTGGG - Intergenic
949511611 3:4771486-4771508 CTTTCACAGTGGAAGGAAGTGGG - Intronic
951326714 3:21311738-21311760 GTTTGTCTAGGGATGGAGGTGGG - Intergenic
952285966 3:31970043-31970065 CTTTTTCTCTGGAAAGAACTTGG - Intronic
953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG + Intergenic
953825190 3:46246050-46246072 CCTAGACTATAGAAGGAAGTAGG - Intronic
956025515 3:64978807-64978829 CATGGTCTATGGGAGGAAGAGGG - Intergenic
956688677 3:71856274-71856296 TTTTCTCTATGGTAGTAAGTTGG + Intergenic
957158274 3:76574626-76574648 GTTTCTCTATGATAGGAAGTGGG - Intronic
957262872 3:77922947-77922969 CTTTGGTTAGGGAAGGAAGTGGG - Intergenic
959372940 3:105551809-105551831 CTTTTTTTAGGGAAGCAAGTCGG - Intronic
960538148 3:118835487-118835509 CTTTTGCTATGGAGGGAAGGAGG - Intergenic
960860880 3:122152406-122152428 TTTTGTATATGGAATGAGGTGGG + Intergenic
960995618 3:123338352-123338374 CTTTGTCTCTGACAGGAGGTGGG - Intronic
961522618 3:127475680-127475702 CTTTGTCCTTGGAGGGAAGCTGG + Intergenic
962104782 3:132379324-132379346 CTGTGTCTATGGAGGAAGGTGGG + Intergenic
962349171 3:134644337-134644359 CTTGGCCTATGGCAGGAACTAGG - Intronic
963876040 3:150475655-150475677 CTTTCTCTATTGAACGATGTTGG + Intergenic
964268934 3:154933888-154933910 CTTTATCCCTGGGAGGAAGTAGG - Intergenic
965760868 3:172074875-172074897 TTTTGTTATTGGAAGGAAGTTGG - Intronic
966778438 3:183563008-183563030 CACTGTCTCTGGAAGGAAGTGGG + Intergenic
968562492 4:1291703-1291725 CATTGTGTATTGAAGGAACTAGG + Intronic
968617412 4:1584350-1584372 CTTTGTATATGGTATGAGGTAGG + Intergenic
968709220 4:2100870-2100892 TTTTGTGTATGATAGGAAGTAGG - Intronic
968840329 4:2999601-2999623 TTTTGTTTATGGAATGAGGTAGG - Intronic
970898676 4:21133227-21133249 CATTGTGTATGTGAGGAAGTAGG - Intronic
970981249 4:22100090-22100112 TTGTGTCTGTGGCAGGAAGTGGG - Intergenic
971366953 4:25985115-25985137 CCTTTTCGATGGAAGGAGGTTGG - Intergenic
971388660 4:26165078-26165100 GTTTGTCTATGGAATGAAAAGGG + Intronic
972421249 4:38888739-38888761 AGTTGTCTATGGAAGGAGGTGGG + Intronic
972766889 4:42159466-42159488 CAGTGACGATGGAAGGAAGTGGG + Intergenic
975102720 4:70532755-70532777 CTTTGGAGATGGAAGAAAGTTGG + Intergenic
975713432 4:77183042-77183064 GTATGTCAATGGAAGAAAGTCGG - Intronic
976316751 4:83666860-83666882 CTCTGTTTATGAATGGAAGTGGG + Intergenic
976632478 4:87253147-87253169 CTTTTTCTATTGAAAGAAGAGGG + Intergenic
977239792 4:94554180-94554202 CATTGTCTCTGGATGGAAGATGG - Intronic
978782580 4:112572099-112572121 TTTTGTATATGGTATGAAGTAGG - Intronic
979125093 4:116960473-116960495 GTATGCCTATGGAAGGAAGAAGG - Intergenic
980008421 4:127567337-127567359 CTTTGTCTCTGGAAAGCACTTGG + Intergenic
984865867 4:184280097-184280119 TTGTGTCTATGGAAGGGACTAGG + Intergenic
986223147 5:5788396-5788418 GGTTGTCCATGGAAAGAAGTGGG + Intergenic
986344978 5:6826628-6826650 CTTTGTCTTTTCTAGGAAGTTGG + Intergenic
987372029 5:17202306-17202328 CTATGTCTGTGAAAGCAAGTTGG + Intronic
988001512 5:25355484-25355506 GTTTGTGTATGTTAGGAAGTGGG + Intergenic
988886743 5:35566047-35566069 ATTTGTCAATGGAAACAAGTAGG + Intergenic
990729970 5:58797553-58797575 CTATCTCTATGGAGGGAAGGAGG - Intronic
991665600 5:68996654-68996676 ATTTTTCTATGGAAGGAGATCGG - Intergenic
993151038 5:84162338-84162360 CAGTGTCTAAGGAAGGAACTGGG + Intronic
993278588 5:85895140-85895162 CTTCCTCTATGAAAGGAATTGGG - Intergenic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
996182926 5:120442020-120442042 CTTTGCCTTAGGCAGGAAGTTGG + Intergenic
996309396 5:122086755-122086777 CTTTGTATATGGTATGAAGTAGG + Intergenic
997888201 5:137650489-137650511 GTTTCTCTATGGAAGTATGTTGG + Intronic
998415446 5:141942851-141942873 TTTTTTCTATGGAAAGAAGTAGG - Intergenic
998986458 5:147763313-147763335 CTTTGTCAATGGGATGAACTGGG - Intronic
999067686 5:148708522-148708544 TTTTGTATATGGTAGGAGGTAGG - Intergenic
1000012855 5:157249057-157249079 CTTTCTCTAGGGAAGGAGGGAGG - Intronic
1003172036 6:3727458-3727480 CTGTTCTTATGGAAGGAAGTGGG - Intronic
1003785316 6:9479300-9479322 ATTTTTCTGTGGAAGGAACTCGG - Intergenic
1006503617 6:34474096-34474118 GTTTATCTATGGGAGGAAGCAGG + Intronic
1008356806 6:50564514-50564536 CTTTGTGTATGGTATGAGGTAGG - Intergenic
1009358351 6:62781172-62781194 TTTTGTAAATGGAAGGAAGTTGG - Intergenic
1011573985 6:88773788-88773810 CTTTGTATATGGTATGAGGTAGG - Intronic
1012673142 6:102081556-102081578 CTTTGTCTTTGGAAGTAAGTTGG + Intergenic
1012692829 6:102336399-102336421 CTTTGAAGATGGAAGGAAGAGGG - Intergenic
1013281276 6:108639241-108639263 CTTTGCATATGAAAGGAAGCAGG - Intronic
1013452790 6:110301437-110301459 CTTGCTTTATGGAAGGAAGTGGG + Intronic
1015240584 6:131018709-131018731 TTTTGTATATGGTATGAAGTAGG + Intronic
1017209966 6:151844703-151844725 CTTTATTTATGGAAGGGAATAGG + Intronic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1018644812 6:165938019-165938041 CTTTGTAGAGGAAAGGAAGTGGG - Intronic
1020994238 7:15242356-15242378 ACTTGTCTATGGATGGAATTAGG - Intronic
1022873964 7:34508788-34508810 CTTTGTGTATGGTAAGATGTAGG - Intergenic
1024245272 7:47464991-47465013 TTTTGTGCATGGAAGGAAATAGG - Intronic
1024410279 7:49032568-49032590 ATTTTTCTGTGGAAGGTAGTTGG + Intergenic
1025213064 7:57032210-57032232 CTTTGCATATGGAGGGAAATTGG + Intergenic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1026887173 7:73957705-73957727 TTTTGTATATGGAATGAGGTAGG + Intergenic
1028577627 7:92369887-92369909 CTCTGTCCATGGAAGGGAGAGGG + Intronic
1028948171 7:96604278-96604300 CTTTTTGTATGGAATGAAGCTGG + Intronic
1031130694 7:117830020-117830042 CTGTTTCTATGGAATGGAGTAGG - Intronic
1032357861 7:131226823-131226845 TTTTGTTTTTGGAAGTAAGTGGG + Intronic
1033620293 7:143056505-143056527 GTTTGTCTATGTAAGGTTGTTGG + Intergenic
1034001554 7:147418765-147418787 CTTTCTCTATAAAAGAAAGTGGG + Intronic
1034006026 7:147473213-147473235 GTTTGTCTATGAAAGGGATTAGG + Intronic
1037715704 8:21396470-21396492 TTTTGTGTATGGAACAAAGTAGG + Intergenic
1037874367 8:22533158-22533180 TTTTCTGTATGGAGGGAAGTAGG - Intronic
1038079218 8:24114156-24114178 CTTTGAGTATGGAATAAAGTGGG + Intergenic
1038396040 8:27246181-27246203 CTTTCTACATGGAAGGAAATGGG + Intronic
1040595666 8:48835238-48835260 CTTTGTCTCTGGAGCAAAGTGGG + Intergenic
1041100591 8:54392740-54392762 CTTTGTCTATGCAGAGAAGGAGG + Intergenic
1041978126 8:63822903-63822925 CTTGGTCTATGGTAGAATGTGGG + Intergenic
1042654866 8:71084988-71085010 CTCTGTCTAAGAAAGGAAGGAGG - Intergenic
1042674402 8:71303774-71303796 CTCTCTCTATGTTAGGAAGTAGG + Intronic
1042857400 8:73281513-73281535 CATGGTCTATGGGAGGTAGTGGG + Intergenic
1042963187 8:74323885-74323907 CTTTCTTTATGAAAGAAAGTTGG + Intronic
1043311171 8:78861238-78861260 TTTTGTCTATGGATGGAACTAGG - Intergenic
1045733377 8:105267227-105267249 CTTTGCCTGTGGAAAGAAGAGGG - Intronic
1048471104 8:134704823-134704845 GTTTGTGTATGGTATGAAGTAGG - Intronic
1050949978 9:11576822-11576844 CTTTACCTATGGAAGGACATAGG + Intergenic
1053322221 9:37109255-37109277 CTTTGTATATGGAGTGAGGTAGG - Intergenic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060298264 9:122357611-122357633 CTTTGTTGTTGGAAGGAAGGAGG + Intergenic
1060386331 9:123232503-123232525 TTTTGTGAATGGAATGAAGTAGG - Intronic
1060681955 9:125573947-125573969 CACAGTCTATTGAAGGAAGTGGG - Intronic
1061099566 9:128482442-128482464 TTTAGGCTATGGAACGAAGTAGG + Intronic
1061574998 9:131500888-131500910 TTTTGACTATGGAAGAGAGTTGG + Intergenic
1062723428 9:138057551-138057573 TTTTGTCTATGGAGTAAAGTAGG + Intronic
1187617311 X:21011318-21011340 TTTTGTATATGGCAAGAAGTAGG - Intergenic
1189021597 X:37347483-37347505 CTTTCTCTCTGGTAGGAACTTGG + Intergenic
1190754926 X:53393295-53393317 ATTTATCTATGGAAGGAACTGGG - Intronic
1191979437 X:66909772-66909794 AATTTTCTATGGAAGGAAGGAGG - Intergenic
1192556427 X:72093534-72093556 CTTGGACTTTGGAAGGAAGCAGG - Intergenic
1193429217 X:81379820-81379842 TTTTGTTTATGGTATGAAGTAGG + Intergenic
1193673604 X:84419443-84419465 CTTTGTCTTTGGAAAGAAAATGG + Intronic
1194185645 X:90771596-90771618 ATTTGACTTTTGAAGGAAGTAGG - Intergenic
1194240670 X:91443478-91443500 CTTTGTGTTTGTAAGGAAATTGG + Intergenic
1195528675 X:105925207-105925229 TTTTGTCTTTGGAAGTAAATAGG - Intronic
1197121252 X:122895663-122895685 CTTTGTCTATATAAGGAAAGAGG - Intergenic
1197559244 X:127997582-127997604 TTTTGTATATGGCAGGAAATAGG - Intergenic
1200532263 Y:4353675-4353697 ATTTGACTTTTGAAGGAAGTAGG - Intergenic