ID: 1079527473

View in Genome Browser
Species Human (GRCh38)
Location 11:21407848-21407870
Sequence GATCTCAGTTGGCAAAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 300}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079527473_1079527475 -6 Left 1079527473 11:21407848-21407870 CCTTTTCTTTGCCAACTGAGATC 0: 1
1: 0
2: 2
3: 10
4: 300
Right 1079527475 11:21407865-21407887 GAGATCCTATCAACTCTCTATGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079527473 Original CRISPR GATCTCAGTTGGCAAAGAAA AGG (reversed) Intronic
903001814 1:20271771-20271793 CATCTTAGTTGACAAAGCAACGG + Intergenic
903478162 1:23634675-23634697 GAACCCAGCTGGCAAAGGAAGGG + Intronic
904671267 1:32167580-32167602 GTTCTCTGTTGGATAAGAAAAGG - Intronic
905421830 1:37852113-37852135 GATCACAGTAGTCAAAGAGATGG - Intronic
906272295 1:44489098-44489120 GATCTCACTTTGCAAGCAAAAGG + Intronic
906869303 1:49459510-49459532 AATCTCAGTTAGAAACGAAATGG - Intronic
906940244 1:50249302-50249324 CATCTCAGTTTCCAAATAAAGGG + Intergenic
908093912 1:60717047-60717069 CATTTCAGTTGGGAAAAAAATGG + Intergenic
909678158 1:78261009-78261031 TATCTCAATAGACAAAGAAAAGG + Intergenic
910061881 1:83103537-83103559 GATCACAGTTGGAAAACAGAAGG - Intergenic
910159271 1:84256165-84256187 GGTCTGAGTTTGCAAAGAGAGGG + Intergenic
911827545 1:102506408-102506430 TATCTCAGTAGACACAGAAAAGG - Intergenic
911995026 1:104756410-104756432 GATGTGAGTTGAAAAAGAAATGG - Intergenic
912138341 1:106689570-106689592 TACTTCAGTTGACAAAGAAATGG - Intergenic
912192219 1:107353249-107353271 GATATGTGTGGGCAAAGAAATGG - Intronic
913269347 1:117077750-117077772 GTTCTCAGTTGGGAAACAAGTGG - Intronic
915717512 1:157958398-157958420 GATATGAGTTGCCAGAGAAAGGG - Intergenic
917029855 1:170678127-170678149 AATCTAAGTTGGCAAAAGAATGG - Intronic
918572372 1:186012620-186012642 GATCTCAGAGGCAAAAGAAACGG - Intronic
919438790 1:197600270-197600292 GATTTCCATTAGCAAAGAAAGGG - Intronic
920044857 1:203126698-203126720 GATCTCAGAATGCAAGGAAAAGG - Intronic
920825331 1:209419639-209419661 GAGCTTAGTTGGGAAAGAATAGG + Intergenic
920867012 1:209761564-209761586 GAGCCCAGTTGCAAAAGAAAAGG + Intronic
921351910 1:214244542-214244564 TATCTTTGTTGGCAAAGACATGG + Intergenic
923459348 1:234195174-234195196 GAAAGCAGTGGGCAAAGAAATGG - Intronic
923803754 1:237236169-237236191 GATCTAAGTAGGAAAGGAAAGGG + Intronic
1063582466 10:7321116-7321138 GCTCTCAGTTAAAAAAGAAAAGG + Intronic
1064550550 10:16496604-16496626 GAACTAGGTTGGCAAAGAGAAGG - Intronic
1067983005 10:51108537-51108559 CATCTCCATTGGCACAGAAAAGG + Intronic
1068207122 10:53870020-53870042 TATCACATTTGGAAAAGAAAAGG + Intronic
1068403433 10:56560107-56560129 TATCTTTGTTTGCAAAGAAAGGG + Intergenic
1068433404 10:56961502-56961524 GATTTCACTTGGAAAAGAAAGGG - Intergenic
1068773142 10:60844432-60844454 GATCTAAGATGGGAAAGAATAGG + Intergenic
1068930983 10:62589950-62589972 TATCTCACTCAGCAAAGAAAAGG + Intronic
1069078488 10:64063675-64063697 AAGCTCAGTTCGCAAAGAGAAGG - Intergenic
1069448875 10:68500049-68500071 AATCTCAGTTGGCCAGCAAAAGG - Intronic
1073225981 10:101919434-101919456 GAGCTTCGTTGGCAAAGAAAGGG - Intronic
1074290407 10:112133806-112133828 GACCTAAGTTGCCACAGAAATGG - Intergenic
1074905567 10:117860329-117860351 GAGTTGAGTTGGCAAAGAATGGG - Intergenic
1078723730 11:13908829-13908851 GAAATCTGCTGGCAAAGAAATGG + Intergenic
1079276626 11:19043902-19043924 TATCTCAATAGACAAAGAAAAGG + Intergenic
1079527473 11:21407848-21407870 GATCTCAGTTGGCAAAGAAAAGG - Intronic
1080109827 11:28554148-28554170 CATTTCTGTGGGCAAAGAAATGG + Intergenic
1080372061 11:31660454-31660476 GTAGTCAGTAGGCAAAGAAAAGG + Intronic
1080412317 11:32037505-32037527 GATTTCAATTGGGAAAGATAGGG - Intronic
1081024163 11:37988063-37988085 GAGATCAGATGGCAAAAAAAAGG - Intergenic
1083000392 11:59285784-59285806 TATCTCAGTTGGAAATGAATGGG + Intergenic
1087056690 11:93943951-93943973 GCTCTCAGTTATAAAAGAAAGGG - Intergenic
1087792090 11:102416899-102416921 CATCTCAGTAAACAAAGAAAAGG + Intronic
1088748836 11:112826670-112826692 GCTCTGAGTTTGCAAAGCAAAGG - Intergenic
1089639042 11:119834939-119834961 ACTCTCAGTGGGCAAGGAAAGGG + Intergenic
1091345743 11:134852710-134852732 AATCCCAGGTGGCCAAGAAAAGG - Intergenic
1093289760 12:17305094-17305116 CATCTCAATAGACAAAGAAAGGG - Intergenic
1093872789 12:24312350-24312372 GATACCAGTGGGCAAAGAATCGG - Intergenic
1094479376 12:30869601-30869623 GATCTCAGTTGAGGAAGAAGAGG - Intergenic
1095603577 12:44041874-44041896 CATCTCAGTAGTCACAGAAAAGG + Intronic
1096886391 12:54723198-54723220 CAACAAAGTTGGCAAAGAAATGG + Intergenic
1097598194 12:61660558-61660580 TATCTCAGTAGACACAGAAAAGG - Intergenic
1098739440 12:74153518-74153540 GATCTCATTTGGAATAAAAAGGG + Intergenic
1098927409 12:76365830-76365852 CATTTCAATTGGCATAGAAAAGG - Intronic
1099132079 12:78846067-78846089 CATCTAAATTGGAAAAGAAAAGG - Intergenic
1099391791 12:82089982-82090004 TATCTCAGGTGGCACTGAAAAGG - Intergenic
1100080783 12:90847381-90847403 TATCCCTGTTGGCAAAGGAAAGG + Intergenic
1100829401 12:98503976-98503998 GAAATCATTTGGTAAAGAAAAGG + Intergenic
1100890228 12:99117430-99117452 TATCTCAGTAGGTACAGAAAAGG - Intronic
1100943320 12:99749211-99749233 AATCTCAGTTGTCAAAGAGATGG - Intronic
1102262904 12:111455799-111455821 GGTCTCAGTTGGAAAACTAAAGG + Intronic
1102939484 12:116926699-116926721 GCTCTCTGTGGGCAAAGAGAAGG - Intronic
1105008801 12:132740625-132740647 GAGCTAAGATGGCAAAGAAGAGG + Intronic
1108203605 13:48066212-48066234 GAGCTCACTTGGCAAAGGCAGGG - Intronic
1108287506 13:48923184-48923206 GATCTCAATTGACAAACACATGG - Intergenic
1109715860 13:66221005-66221027 TATCTCAGTTGGGGAGGAAAGGG + Intergenic
1110512411 13:76366563-76366585 CATCTCAATTGACACAGAAAAGG + Intergenic
1110644415 13:77865990-77866012 GAGCTCACTATGCAAAGAAATGG + Intergenic
1111172656 13:84548876-84548898 GATCTAATTTGAAAAAGAAAAGG + Intergenic
1111301120 13:86352080-86352102 GATTACAGTTGCAAAAGAAAAGG - Intergenic
1111332488 13:86778190-86778212 TATCTCAATAGGCACAGAAAAGG - Intergenic
1112197604 13:97241221-97241243 GTTCTCAGTGGGGAAAAAAAAGG - Intronic
1114092588 14:19302642-19302664 GGGCTCAGTGGGCAAAGAGAGGG + Intergenic
1114168273 14:20244394-20244416 GGGCTCATGTGGCAAAGAAATGG - Intergenic
1117737410 14:58781735-58781757 GACCTCAGTTAGAAAAGAAAAGG - Intergenic
1119871259 14:78020000-78020022 GATGGCAGCAGGCAAAGAAAGGG + Intergenic
1121052493 14:90828619-90828641 GACCACAGTGGGCAAATAAAAGG - Intergenic
1123065217 14:105615605-105615627 GCTCTCAGTTTGGAAACAAAAGG - Intergenic
1123069415 14:105635041-105635063 GCTCTCAGTTTGGAAACAAAAGG - Intergenic
1125120317 15:36150013-36150035 CATCTCAGTTGATGAAGAAAAGG + Intergenic
1125386628 15:39143686-39143708 GATCACAGCTGCCAAAGAACTGG - Intergenic
1126319135 15:47403262-47403284 AATCTCTGTTAGAAAAGAAAGGG + Intronic
1127605322 15:60581573-60581595 GATCTCTGTTGAAAAAGATATGG + Intronic
1129580755 15:76807280-76807302 TATCTCAGTTGGTGCAGAAAAGG - Intronic
1131377098 15:91934489-91934511 GAAGTCATTTGGCAAAGAAGTGG - Intronic
1133716579 16:8455448-8455470 CATCCAAGTTGGTAAAGAAAAGG + Intergenic
1134382579 16:13741545-13741567 CATCTCATTGGGCAAAGAATAGG + Intergenic
1135574425 16:23574470-23574492 GACCACAACTGGCAAAGAAATGG - Intergenic
1135795639 16:25439380-25439402 GATCTCAGTAGACAGTGAAAAGG - Intergenic
1136453413 16:30367598-30367620 GAACTTAGCAGGCAAAGAAAGGG + Intronic
1137529659 16:49270493-49270515 GAGCTCAGCTGGTAAAGAAGAGG + Intergenic
1137911110 16:52379412-52379434 GATCTCATTTGGAAATAAAAGGG + Intergenic
1138580005 16:57934619-57934641 GATCTCAGATGGTACAGACAAGG + Intronic
1140163504 16:72525119-72525141 GTTTCCAGTTGGCATAGAAAAGG - Intergenic
1141521883 16:84585945-84585967 GATCCCAGTTGTTAGAGAAAGGG - Intronic
1141736918 16:85860090-85860112 GATCTCAGGTGGCAATGCCAAGG + Intergenic
1149189047 17:54036535-54036557 GATCTCACTAGGCCAAGAGAAGG + Intergenic
1149525035 17:57348828-57348850 GATGTGAGTTGGGAAAGAGAAGG - Intronic
1151108429 17:71646686-71646708 TATCTCAATAGACAAAGAAAAGG + Intergenic
1151113142 17:71703168-71703190 GATCTCAGTGGTAAATGAAAAGG - Intergenic
1153069532 18:1089481-1089503 CCTCTCAGCTGCCAAAGAAAAGG + Intergenic
1153528448 18:6019821-6019843 GATCTAAATTTGCACAGAAAAGG - Intronic
1153763995 18:8357650-8357672 GATCTCCTTAGGCAACGAAATGG + Intronic
1154945015 18:21153813-21153835 CATCTCAGTAGACACAGAAAAGG - Intergenic
1155682704 18:28508990-28509012 CATTTCAATTGGCAAAGACATGG + Intergenic
1156383517 18:36585437-36585459 AATCTCAGTAGGAAAAAAAAGGG + Intronic
1157397499 18:47355113-47355135 GCTCTCAATGGGCAAAGGAAGGG - Intergenic
1161302354 19:3548776-3548798 GAGGTCAGCTGGCAAAGCAATGG + Intronic
1162783756 19:13021496-13021518 GGTTTCAGTTGGGGAAGAAAGGG + Intronic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1163350373 19:16773163-16773185 GATGTGAGGTGGCGAAGAAATGG - Exonic
1164482582 19:28624712-28624734 TATCTCAGTAGACACAGAAAAGG - Intergenic
1166290302 19:41859528-41859550 AATCTAAATTGGCAAAGTAAGGG + Intergenic
925106573 2:1297341-1297363 AATATCAGATGGCAAAGTAACGG - Intronic
926290510 2:11525589-11525611 GGCCTCAGTTGGCCAAGACATGG + Intergenic
926607926 2:14915897-14915919 GATGGCAGTAGGCAAAGAGAGGG - Intergenic
927422678 2:22949452-22949474 CAAGTCATTTGGCAAAGAAAGGG - Intergenic
928448762 2:31358906-31358928 CATCTCAGTATGTAAAGAAAAGG + Intronic
929858780 2:45657646-45657668 CATCTCATTTGGCAAAGAATGGG + Intronic
930522828 2:52489333-52489355 TATCTCAGTTGATACAGAAAAGG - Intergenic
931880616 2:66566453-66566475 GATCTGAGTTGGGAACTAAAAGG + Intronic
932915154 2:75849905-75849927 TGTCTCAATTGGCAAAAAAATGG - Intergenic
933383490 2:81581639-81581661 CATTTCAGTTGGGAAAGAATTGG - Intergenic
934480054 2:94629653-94629675 GATCTCTGCTGGCAAATTAAAGG + Intergenic
937200193 2:120197879-120197901 CATCTCAATTGACACAGAAATGG + Intergenic
939386975 2:141513788-141513810 GATCTCAGTTCACAAAGTAAAGG + Intronic
940485811 2:154294378-154294400 CATCTTAATTGGCAAAGATAAGG - Intronic
943187280 2:184627184-184627206 GATCAGAGTTGACAAAAAAATGG - Intronic
943348604 2:186771412-186771434 GATCTCAGTTGGAAAAAAAATGG + Intergenic
943979488 2:194529763-194529785 GAGCTCAGGTGGCAATGCAAGGG + Intergenic
944187648 2:196967232-196967254 GTTCCCAGTTGGAAAATAAAGGG + Intronic
944851182 2:203721176-203721198 GATCTATGTTGACAAAGAAGAGG + Intronic
946720797 2:222604966-222604988 TATCTCAGCTGGCATAGATATGG - Intronic
947164307 2:227246353-227246375 GAGCTCAGTTCGAAAACAAAAGG - Intronic
947884713 2:233558414-233558436 AATCTCATTTGGCAATAAAATGG + Intronic
948192143 2:236067912-236067934 TATCTCATCTGGCAAAGAGAAGG + Intronic
948434843 2:237946076-237946098 GATCCCACTTGGGTAAGAAATGG + Intergenic
948767660 2:240231819-240231841 GACCTCAGTTTGAAAAAAAAAGG + Intergenic
1170351867 20:15450371-15450393 GGTATCATTTGGGAAAGAAATGG - Intronic
1170396886 20:15935305-15935327 GAGCTCACTTGGAAAAGTAAGGG - Intronic
1172765497 20:37348584-37348606 GAGTTCACTTGGCAAAGAAGGGG + Intronic
1173205040 20:40986184-40986206 CATCTCAGGAGGTAAAGAAATGG - Intergenic
1173316444 20:41948975-41948997 GGTCCCAGTTAGCAAAGTAATGG - Intergenic
1174537648 20:51264753-51264775 TATCTCAATTGATAAAGAAAAGG + Intergenic
1175223691 20:57432799-57432821 GGTCTCAGTTTGAAAAAAAAGGG - Intergenic
1175273324 20:57750037-57750059 GATCGCAGTTGCGCAAGAAAGGG - Intergenic
1176988210 21:15462407-15462429 GATCTCAGAGGACAAAGGAAAGG - Intergenic
1177196227 21:17906205-17906227 GATCTGAGATGGGAAAGCAAAGG + Intronic
1177805910 21:25874581-25874603 GATCTCAGTAGGCCCAGAATGGG + Intergenic
1179401363 21:41086973-41086995 GTTCTCTGTTGGAAAGGAAATGG - Intergenic
1179947998 21:44692112-44692134 GATCTCAATTAACAAAGAAAAGG + Intronic
1180488141 22:15819924-15819946 GGGCTCAGTGGGCAAAGAGAGGG - Intergenic
1181376246 22:22460429-22460451 GCTTTCTGTTAGCAAAGAAATGG + Intergenic
1181376831 22:22465426-22465448 GCTTTCTGTTAGCAAAGAAATGG + Intergenic
1181902119 22:26164894-26164916 AATCTGAGTAGACAAAGAAATGG + Intergenic
1182167317 22:28189004-28189026 GAACTCAGGGGGAAAAGAAAGGG + Intronic
952434973 3:33264202-33264224 GAGCTCAGTTAGAAATGAAATGG - Intergenic
952574862 3:34762398-34762420 TATCTCAATTGACACAGAAAAGG + Intergenic
953098561 3:39803497-39803519 GATCTTAGTTTTAAAAGAAATGG + Intergenic
953760741 3:45684903-45684925 GCTTTCTGTTGGAAAAGAAATGG + Exonic
953977546 3:47393678-47393700 GATCTGAGTCTGCAAAAAAAAGG - Intronic
956965020 3:74449213-74449235 GATGTCAGTTGGCAATGAAATGG - Intronic
956988991 3:74741136-74741158 GATCTCAGTTAGTGCAGAAATGG - Intergenic
958131239 3:89426963-89426985 GATCTAAGTTTCCAAGGAAATGG + Intronic
958907430 3:99957192-99957214 GATCTGATTTGGCAGTGAAAGGG + Intronic
960730603 3:120722619-120722641 CATCACAGATGCCAAAGAAATGG + Intronic
961054517 3:123776815-123776837 GATCACAGTTGGTAAAGGATGGG + Intronic
962558139 3:136577398-136577420 GATCTTAACTGGCAAAGAATGGG + Intronic
963910544 3:150813885-150813907 GATCTCCTTTGGCCAAGAAGGGG + Intergenic
963982688 3:151557532-151557554 GCTCTCAGTTTGCATACAAAGGG + Intergenic
964294807 3:155221850-155221872 TATCTCAATAGGCACAGAAAAGG - Intergenic
964545132 3:157826166-157826188 GTTCACAGTTAGCAAATAAATGG + Intergenic
964659254 3:159101591-159101613 GAGCTCTGTTGGCAAAGATGAGG - Intronic
964991209 3:162814844-162814866 TATCTCAATAGACAAAGAAAAGG - Intergenic
965374639 3:167908122-167908144 AAACTCAGTTGGCAAAAGAAGGG + Intergenic
966133925 3:176676730-176676752 TATCTCAATAGGCACAGAAAAGG + Intergenic
970347679 4:15169455-15169477 GACCTCAGTTTCCAAAGAATAGG + Intergenic
970866209 4:20761800-20761822 GTTTTCATTTGGCAGAGAAAAGG - Intronic
971855515 4:32038448-32038470 GAAATCTCTTGGCAAAGAAATGG - Intergenic
972447232 4:39156650-39156672 GATATCATTTGGCAATTAAAAGG + Intergenic
973538933 4:51915158-51915180 GAACACTGTTTGCAAAGAAATGG - Exonic
974133205 4:57782046-57782068 TATCTCAATTAGAAAAGAAATGG - Intergenic
974650121 4:64744121-64744143 GCTCTGAGGTTGCAAAGAAAAGG - Intergenic
975264692 4:72348836-72348858 GATCTCAGCTTGCAAAAACAAGG + Intronic
975688651 4:76944275-76944297 GCTATCAGATGACAAAGAAAAGG + Intergenic
976007437 4:80446574-80446596 GATCTAAGCTGGAAAAAAAATGG - Intronic
976375976 4:84345356-84345378 TATCTCAATAGGCACAGAAAAGG + Intergenic
976969497 4:91088015-91088037 GATCTCACTTGCTTAAGAAATGG + Intronic
977059072 4:92233807-92233829 GATGGCAGTTGTCAGAGAAAAGG + Intergenic
977564295 4:98566132-98566154 AATCTCAGTTGCCAGAGTAAGGG - Intronic
977859482 4:101939111-101939133 GAACCCATTTGGGAAAGAAATGG - Intronic
977987540 4:103401506-103401528 TATCTCTGAGGGCAAAGAAAGGG - Intergenic
978289177 4:107117146-107117168 AATTTCAGTTGAAAAAGAAAAGG + Intronic
978405572 4:108375346-108375368 AATTTCAGTTGTCAAAAAAAAGG + Intergenic
978940595 4:114431740-114431762 GATCTCAATAGACAGAGAAAAGG - Intergenic
980090561 4:128438706-128438728 CATCTCAATAGACAAAGAAAAGG - Intergenic
980641035 4:135579871-135579893 GATATCTGTTTGCAAGGAAATGG + Intergenic
980648557 4:135678983-135679005 GATCTCAATAGACACAGAAAAGG + Intergenic
983186120 4:164702342-164702364 GAACTCAGAAGGCCAAGAAATGG + Intergenic
983381888 4:167005798-167005820 AATCTCATTTGATAAAGAAAAGG + Intronic
983997393 4:174200738-174200760 AAACTGGGTTGGCAAAGAAAAGG + Intergenic
986935780 5:12884412-12884434 ATTCTCAGTGGGCCAAGAAATGG + Intergenic
989388242 5:40874326-40874348 GAAGTGAGTTGGAAAAGAAAGGG - Intergenic
989464106 5:41734943-41734965 GATAACTGTTGGCAAAGATATGG + Intronic
989966112 5:50467525-50467547 TATCTCAGTAGACACAGAAAAGG - Intergenic
990473896 5:56143089-56143111 GATTTCTGTTGGCCCAGAAAGGG - Intronic
990990312 5:61677571-61677593 GATCTGAGCTAGCAAAGTAAAGG + Intronic
993474050 5:88343068-88343090 CATATCAATTGACAAAGAAAAGG - Intergenic
993743536 5:91567811-91567833 GAGCTCAGTTAGAAATGAAATGG + Intergenic
994034704 5:95185428-95185450 CATATCAATTGGCACAGAAAAGG + Intronic
994207703 5:97054029-97054051 AAGCTCAGTTAGAAAAGAAATGG - Intergenic
994496812 5:100523187-100523209 AAGCTCAGTTGGAAATGAAATGG + Intergenic
994976158 5:106809801-106809823 AGTTCCAGTTGGCAAAGAAAGGG - Intergenic
997789854 5:136749004-136749026 GATATCAGTTGAAAAAGATACGG - Intergenic
998178249 5:139915275-139915297 CATCTCAGTAGGAAAAGAGAAGG - Intronic
999882902 5:155886972-155886994 GGTTTCAGATGGCAGAGAAAGGG - Intronic
1002047103 5:176548348-176548370 CATCACAGTTGACACAGAAAGGG - Intronic
1002982823 6:2158794-2158816 GATGCCGGTTGGCAAAGGAAAGG - Intronic
1005369688 6:25119266-25119288 CATCTCAATTGACACAGAAAGGG + Intergenic
1007037727 6:38692765-38692787 CATATCAGTTGGTACAGAAAAGG - Intronic
1007415000 6:41686375-41686397 GATCTCAGTTTGCACAGAATGGG + Intronic
1008146715 6:47900752-47900774 CATCTCAATAGACAAAGAAAGGG - Intronic
1009028269 6:58025788-58025810 GAATTAACTTGGCAAAGAAAGGG - Intergenic
1009203802 6:60777172-60777194 GAATTAACTTGGCAAAGAAAGGG - Intergenic
1010022130 6:71173049-71173071 GAACACAGTTGGCAAAAATATGG - Intergenic
1010324206 6:74545883-74545905 GATGGCAGCAGGCAAAGAAAGGG + Intergenic
1010407222 6:75519148-75519170 GCGCTCAGTTGCCAAAGACAAGG - Intergenic
1010699975 6:79032421-79032443 GAACTCAGTTGGTAAAGCAGTGG - Intronic
1012418329 6:99034346-99034368 GCTCTCAGTTTGCAAAGATGTGG - Intergenic
1012725894 6:102809355-102809377 GACTTCCGTTGGCTAAGAAAGGG + Intergenic
1013669603 6:112385541-112385563 TATCTCAATAGACAAAGAAAAGG + Intergenic
1014762605 6:125373882-125373904 GACATCAGTTGACAAATAAATGG + Intergenic
1015998097 6:139015109-139015131 GATTTCAGTAGGCAAAGGTAAGG + Intergenic
1016555303 6:145329502-145329524 AATCTCAGATTGCAATGAAATGG + Intergenic
1017875279 6:158519168-158519190 TATCCCATTTAGCAAAGAAATGG - Intergenic
1018453316 6:163929233-163929255 GATGGCAGTGGGAAAAGAAAAGG + Intergenic
1018517629 6:164603053-164603075 GATCCCAGCTGGAAAAGAAGAGG - Intergenic
1021636306 7:22697599-22697621 ACTCACTGTTGGCAAAGAAAGGG - Intergenic
1024990166 7:55228021-55228043 TATCTCAGTAGACACAGAAAGGG - Intronic
1026434507 7:70383818-70383840 GATCCCACTTTGCAGAGAAAGGG - Intronic
1027440616 7:78215603-78215625 GATCAGAGTTGGCAAAAGAATGG - Intronic
1030717415 7:112825918-112825940 CATTTCAGTAGGCACAGAAAAGG - Intronic
1031744449 7:125476102-125476124 GCTCTCAGTAGACAAAGCAAAGG + Intergenic
1031904858 7:127449185-127449207 GATCTCAATAGACACAGAAAAGG + Intergenic
1032786630 7:135205882-135205904 GAGCACAGAGGGCAAAGAAAAGG + Intronic
1033343241 7:140508011-140508033 GTTCTTAGTTGGCTAAGAGAAGG - Intergenic
1034894612 7:154868423-154868445 GACTTCAGATGGCACAGAAAGGG - Intronic
1037029356 8:14083735-14083757 AATTTCAGTTGGCATTGAAATGG + Intergenic
1037164055 8:15805562-15805584 CATCTCAATAGGCATAGAAAAGG - Intergenic
1039218235 8:35297610-35297632 GATTACAGGTAGCAAAGAAAAGG - Intronic
1039368627 8:36960772-36960794 AATGTCAATTGGCAAATAAATGG - Intergenic
1039804387 8:40986116-40986138 GCTCCCAGAGGGCAAAGAAAGGG - Intergenic
1040486973 8:47882948-47882970 GAGCTGAGTTGCCACAGAAATGG - Intronic
1040874018 8:52131350-52131372 GATCACTGTTGCCCAAGAAAGGG + Intronic
1041341848 8:56854496-56854518 TATCTCAATAGGCACAGAAAAGG - Intergenic
1041881331 8:62753419-62753441 TATCACATGTGGCAAAGAAAGGG + Intronic
1042556773 8:70039920-70039942 TATCTCAATTAACAAAGAAAAGG + Intergenic
1043133152 8:76487469-76487491 GATGTCAATTGGCACAGAAATGG + Intergenic
1043633375 8:82364599-82364621 GATGTCAGTTGCCATATAAAAGG + Intergenic
1044836489 8:96300426-96300448 GAGCTAAGTCAGCAAAGAAAAGG - Intronic
1045195965 8:99930862-99930884 GAACTCAGTTGGAGAAGAAAAGG + Intergenic
1045732635 8:105260053-105260075 TATCTCAGTAGACACAGAAAAGG - Intronic
1046429328 8:114103496-114103518 TATCTCAATAGACAAAGAAATGG + Intergenic
1046752185 8:117937689-117937711 GATCTCAGTTTTCCAACAAATGG - Intronic
1046773190 8:118136909-118136931 AATCTCTATTGCCAAAGAAATGG - Intergenic
1047210757 8:122838133-122838155 GCTCTCAGTTTGCAGAGCAAGGG + Intronic
1048799443 8:138182495-138182517 GCACTCAGTTGGCAGAGCAAGGG - Intronic
1048825450 8:138420750-138420772 CATCTCAATAGGCACAGAAAAGG + Intronic
1049195419 8:141313080-141313102 GATCCCAGTTTGAAAGGAAAGGG + Intergenic
1050058062 9:1676562-1676584 GATGTCAGTTGCCACAGGAAGGG + Intergenic
1053677785 9:40454148-40454170 GATCTCTGCTGGCAAATTAAAGG - Intergenic
1053927702 9:43081983-43082005 GATCTCTGCTGGCAAATTAAAGG - Intergenic
1054285941 9:63170807-63170829 GATCTCTGCTGGCAAATTAAAGG + Intergenic
1054290858 9:63289674-63289696 GATCTCTGCTGGCAAATTAAAGG - Intergenic
1054388879 9:64594221-64594243 GATCTCTGCTGGCAAATTAAAGG - Intergenic
1054506838 9:65922150-65922172 GATCTCTGCTGGCAAATTAAAGG + Intergenic
1056034548 9:82590030-82590052 GAACTCTATTTGCAAAGAAAGGG - Intergenic
1056762626 9:89425946-89425968 GCTGGCAGTTGGCAAAGAGAAGG - Intronic
1059038734 9:110789074-110789096 AATCTAAGTTGGGAAACAAATGG + Intronic
1059454760 9:114392897-114392919 TATCTCAGTTGGCTGAGAAGGGG - Intronic
1059835558 9:118148162-118148184 GAGTCCAGTTGGCAATGAAAGGG + Intergenic
1060079307 9:120626990-120627012 ATTCCCAGTTGGCAAAGACAGGG + Intronic
1061176920 9:129003194-129003216 ATGCTGAGTTGGCAAAGAAATGG - Intronic
1186003504 X:5041640-5041662 GATCATATTTGGCAAAGACAAGG - Intergenic
1186215091 X:7291113-7291135 GATCTCAGATGACAAAGTTATGG - Intronic
1186723840 X:12335591-12335613 CATCTCAGTGGGGAGAGAAATGG - Intronic
1186871231 X:13775881-13775903 AATATCCCTTGGCAAAGAAATGG + Intronic
1187340186 X:18414178-18414200 AATATCAGTTGGCAATAAAAAGG - Intergenic
1188072398 X:25732716-25732738 AAGCTCAGTTGACAAAGAAGTGG + Intergenic
1188247574 X:27854048-27854070 GATCCCCGGTGGCAAAGAAGTGG - Intergenic
1188295254 X:28439767-28439789 GATCTCACTAGCCAAAGAAGAGG + Intergenic
1189176058 X:38958635-38958657 GATCTCATTTTGTGAAGAAAAGG + Intergenic
1190110819 X:47587898-47587920 TATCTCCTTTGGTAAAGAAAAGG + Intronic
1192469822 X:71388195-71388217 TATTTTATTTGGCAAAGAAAAGG - Intronic
1193436587 X:81481191-81481213 TATCTCAATTGACACAGAAAGGG + Intergenic
1194404074 X:93472456-93472478 TATCTCAATAGGCACAGAAAAGG + Intergenic
1194416018 X:93612999-93613021 GAACTCAGGTGTCAAAGACAGGG - Intergenic
1195142348 X:101974797-101974819 CATCTCAGTAGACACAGAAAGGG - Intergenic
1196029724 X:111083583-111083605 TATTTCAGGTGGCAAAGGAAAGG - Intronic
1196042712 X:111222805-111222827 GATCACTGTAGGCAGAGAAATGG + Intronic
1196484776 X:116193241-116193263 TATCTCAGTTGGTTAATAAAAGG + Intergenic
1196486436 X:116215677-116215699 CATCTCAATTGACACAGAAAAGG + Intergenic
1197498286 X:127213049-127213071 GATCCCTGTTTGCAAAAAAAAGG + Intergenic
1198129609 X:133680469-133680491 GATCTCAGCGGGCAAAAAATAGG + Intronic
1199228359 X:145406720-145406742 GAGCTAAATTTGCAAAGAAAAGG + Intergenic
1199364549 X:146964798-146964820 TATCTGAGTCTGCAAAGAAATGG + Intergenic
1199701781 X:150383945-150383967 AATATTATTTGGCAAAGAAAAGG - Intronic