ID: 1079532894

View in Genome Browser
Species Human (GRCh38)
Location 11:21476796-21476818
Sequence AGGGAGAGCACAATGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 637
Summary {0: 1, 1: 29, 2: 67, 3: 170, 4: 370}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079532887_1079532894 28 Left 1079532887 11:21476745-21476767 CCCAGGTGGTAGCGGCATAGTGC 0: 1
1: 0
2: 1
3: 5
4: 69
Right 1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG 0: 1
1: 29
2: 67
3: 170
4: 370
1079532888_1079532894 27 Left 1079532888 11:21476746-21476768 CCAGGTGGTAGCGGCATAGTGCA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG 0: 1
1: 29
2: 67
3: 170
4: 370
1079532886_1079532894 29 Left 1079532886 11:21476744-21476766 CCCCAGGTGGTAGCGGCATAGTG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG 0: 1
1: 29
2: 67
3: 170
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079532894 Original CRISPR AGGGAGAGCACAATGATTGT GGG Intronic
901223521 1:7597588-7597610 AGAGAGAGGAGCATGATTGTGGG + Intronic
902157696 1:14502950-14502972 CAGGAGAGAAGAATGATTGTGGG - Intergenic
904116969 1:28170038-28170060 AGTGAGAGCTCATTGAATGTTGG + Intronic
904875914 1:33654468-33654490 AGGGAGAGCACAGTTGTTGCAGG + Intronic
905227005 1:36485639-36485661 AGGGAGAGGAGAAGGATTGCAGG - Intergenic
905435008 1:37950028-37950050 AGGGAGAGCATGATGTGTGTGGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906390931 1:45415433-45415455 AGCGAAAGCACAAAGATTATGGG - Intronic
906547318 1:46629003-46629025 AGGAAGAGCACAATGTGTTTAGG + Intergenic
906634471 1:47399479-47399501 AGGAAGAGGGAAATGATTGTTGG + Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
909299221 1:73989992-73990014 AGGGAGTGAAAATTGATTGTTGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910020446 1:82583177-82583199 GGGGAGTGCAAAATGAGTGTCGG - Intergenic
910384225 1:86664350-86664372 AGGCAGAGCACAGTGATTACAGG + Intergenic
910384430 1:86665570-86665592 AGGCAGAGCACAGTGATTACAGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910476836 1:87616518-87616540 TGGGAGAGCAGAGTGATTATAGG + Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911019729 1:93374634-93374656 GGGGAGAGCACAGTTATTATGGG + Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912788706 1:112629844-112629866 AGGGAGGGCACTATGAGTGAGGG - Intronic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
913507449 1:119530678-119530700 AGGTAGAGGACAAAGATTTTAGG + Intergenic
913648883 1:120890405-120890427 AGCAAGAGCACAAAGATTCTAGG - Intergenic
914077808 1:144372978-144373000 AGCAAGAGCACAAAGATTCTAGG + Exonic
914101371 1:144593527-144593549 AGCAAGAGCACAAAGATTCTAGG - Exonic
914172717 1:145241518-145241540 AGCAAGAGCACAAAGATTCTAGG + Intergenic
914297609 1:146344109-146344131 AGCAAGAGCACAAAGATTCTAGG + Intergenic
914527374 1:148482646-148482668 AGCAAGAGCACAAAGATTCTAGG + Exonic
915374955 1:155386001-155386023 AGGGAGAGACATATGATTGTTGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919098785 1:193068186-193068208 AAGGAGAGCACCATGATTATTGG + Intronic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
919648652 1:200123371-200123393 AGAGAGAGCAAAATGAGTTTGGG + Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920601406 1:207328736-207328758 AGGTAAAGCACAATGATTTAGGG - Intronic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
921291493 1:213662064-213662086 AGGGAGAACCCAATGTTTCTAGG + Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1062929890 10:1345683-1345705 AGGGACAGGACAAGAATTGTAGG + Intronic
1064416518 10:15154689-15154711 AGTGAGAGCACAAAGATTCTAGG + Intronic
1064426100 10:15230964-15230986 GGGGAGCACACAAGGATTGTGGG + Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1066110111 10:32188212-32188234 AGCAAGAGCACAAAGATTCTAGG + Intergenic
1066209575 10:33223816-33223838 AAGGAGAGCACCATCATTGGCGG - Intronic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1070286752 10:75089134-75089156 AGTGAGAGCACAAAGATTCTAGG + Intergenic
1070409963 10:76130569-76130591 AGGGAAAGCATATTGTTTGTAGG + Intronic
1070715140 10:78714726-78714748 AGGTAGAGAACAATGTTTGCAGG - Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1074057367 10:109934795-109934817 AGACAGAGCACAATAAATGTTGG + Intergenic
1074578113 10:114690036-114690058 AGCAAGAGCACAAAGATTCTAGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079473998 11:20808797-20808819 AGAGGGAGTACAATGATTGTGGG - Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1079556741 11:21768106-21768128 AGGGAGTGAACAATGAAGGTAGG - Intergenic
1079760146 11:24319148-24319170 AGAGAGAGTGCAAGGATTGTGGG - Intergenic
1080351004 11:31385944-31385966 AGGGAGAGCACCATGCTCGTAGG + Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081479068 11:43466963-43466985 AGTGAGAGCACAAATATTATAGG - Intronic
1082844998 11:57717925-57717947 AGTGAGAGCACAAAGATTCTAGG + Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1086261619 11:84947019-84947041 AGGGAGAGCAAAGTGATGGCTGG - Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1087632506 11:100667051-100667073 AGCGAGAGCACAAAGATGATAGG - Intergenic
1088074785 11:105833941-105833963 AGGCATAGTAAAATGATTGTAGG - Intronic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088803960 11:113333798-113333820 AAAGAGAGAACAATAATTGTTGG - Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090439474 11:126713877-126713899 AGGGGGAGCACAGTGCTTGGAGG + Intronic
1092039819 12:5374338-5374360 AGGGAATGCAGAATGTTTGTAGG - Intergenic
1092251393 12:6899954-6899976 CTGTAGTGCACAATGATTGTGGG + Intronic
1092473909 12:8802923-8802945 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1092647754 12:10596315-10596337 AGTGATAGCACAATTATTATTGG + Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1094478637 12:30862273-30862295 AGTGAGAGCACAAAGATTATAGG - Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095820413 12:46472383-46472405 AGGGTGAGCTCAATGCTTGGTGG - Intergenic
1095856844 12:46869632-46869654 AGGGAGAGAAAAATGATGCTTGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1095902394 12:47341499-47341521 AGTGAGAGCACAAAGATTATAGG + Intergenic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1098649174 12:72942150-72942172 AGGCAGAGCACAATGAATACGGG - Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1100838644 12:98590613-98590635 AGTGAGAGCACAAAGATTCTAGG + Intergenic
1101252100 12:102946556-102946578 AGGGACAGCAAAGGGATTGTGGG - Intronic
1101696530 12:107132491-107132513 AGGCAGAGCTCACTGACTGTGGG + Intergenic
1104568470 12:129904531-129904553 AGGGAGAGCGCAAGGATGGCTGG + Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1106457212 13:29937904-29937926 AGGCAGAGAACAAAGATTGGTGG + Intergenic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1107932894 13:45320993-45321015 AGAGAGAGCACACTAAGTGTTGG + Intergenic
1107947951 13:45436725-45436747 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1108686261 13:52821408-52821430 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1108972926 13:56400619-56400641 AAGGAGATCACAATGATTGTGGG + Intergenic
1109639560 13:65172005-65172027 AGGAAAAACACAATGATGGTTGG - Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110222744 13:73090550-73090572 AGGGAGAGAACAATGCTTCCAGG + Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111568677 13:90049014-90049036 AGGGAGAGCAAAATGAATATGGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113571010 13:111357818-111357840 AGGGAGAGGACCAGGTTTGTGGG - Intergenic
1114656249 14:24317306-24317328 ATGGAGAGGACAAAGATTATTGG - Exonic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1115930085 14:38481842-38481864 AGGCACAGCAAAATGATTATGGG + Intergenic
1115986600 14:39108808-39108830 AGTGAGAGCACAAAGATTATAGG - Intronic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1116541806 14:46109268-46109290 CTGAAGAGCACAATGATTGTGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117545097 14:56787093-56787115 AGGGAGAACATAATGATGGGTGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118699739 14:68421590-68421612 AGCGAGAGCACAAAGATTCTAGG + Intronic
1118956532 14:70488219-70488241 AGAGAGAGCACAACAATTGGAGG + Intergenic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1120724336 14:87921018-87921040 AGGGAGAGGAAAATGGATGTTGG - Intronic
1122351708 14:101098813-101098835 AGGGAGAGAACAATTGTTCTGGG - Intergenic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127509313 15:59624514-59624536 AGTAAGAGCACAATAGTTGTGGG - Intronic
1128248898 15:66151401-66151423 AGGGAGAGAACCCTGAGTGTGGG + Intronic
1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG + Intronic
1129260206 15:74362132-74362154 AGCGAGAGCACAAAGATTCTAGG - Intronic
1129469947 15:75747348-75747370 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1130007661 15:80116230-80116252 AGGGAGAAAACACTGATTTTTGG - Intronic
1130336250 15:82959437-82959459 AGGCAGAGCACAGTCATTGCAGG + Intronic
1134407164 16:13970585-13970607 TGGGACAGCACAGTGATTGCAGG - Intergenic
1137550333 16:49433211-49433233 AGGGTGAGCTAAATGATTGGTGG + Intergenic
1137780816 16:51096353-51096375 TGTGAGTGCACAATGTTTGTGGG - Intergenic
1137839009 16:51622573-51622595 AGGGAAAGCACACTGCTTTTAGG + Intergenic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139354593 16:66360047-66360069 GTGGAGAGCACAAGGAATGTAGG + Intergenic
1141137454 16:81475601-81475623 AGTGAGAGCACAAAGATTCTAGG + Intronic
1141429132 16:83961861-83961883 AGGGAGACCACAAGGACTGGGGG - Intronic
1142014323 16:87736178-87736200 CGGGAGAGCCCAATGCTTATAGG + Intronic
1142065931 16:88062774-88062796 AGGGATTGCACATTCATTGTTGG + Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146080409 17:29774951-29774973 AGTGAGAGCACAACGAGTATAGG - Intronic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146242678 17:31244616-31244638 ACGGACAGCACAGTGATTATGGG - Intronic
1147430645 17:40368529-40368551 ATCGAGAGCACAAAGATTCTAGG - Intergenic
1148012416 17:44494008-44494030 ATGGAGAGCAAGATCATTGTAGG - Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1152411701 17:80127686-80127708 GGGGAAAGCATAATGATTTTTGG - Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1156912999 18:42433560-42433582 AGGGAGAGCACCAAGTATGTGGG - Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158592892 18:58792256-58792278 AGGGAGAGGACAATGATTCCGGG - Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1161998525 19:7729471-7729493 AGGGAGAGCCCAATGACGCTTGG - Exonic
1162700128 19:12508356-12508378 AGCAAGAGCACAAAGATTCTAGG - Intronic
1164655961 19:29922058-29922080 AGTGAGAGCACAAAGATTATAGG - Intergenic
1165645267 19:37430885-37430907 AGGGAGACCAGAGTGATTGCAGG + Intronic
1166571900 19:43802343-43802365 AGGCAGAGCAGAATGACTCTGGG + Exonic
1166623919 19:44332318-44332340 TGGGGCAGCACACTGATTGTGGG + Intronic
1167681691 19:50926970-50926992 AGTGAGAGCACAAAGATTCTAGG + Intergenic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
926320042 2:11743345-11743367 AGGGAGAGGACAGTGATCCTCGG - Intronic
926374836 2:12216228-12216250 AGGGAGAGGATAATGCTTATTGG + Intergenic
926439103 2:12869184-12869206 ATGGAGAGGACAAAGTTTGTTGG + Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927474109 2:23399203-23399225 AGTGACAGCACAAAGATTCTAGG - Intronic
928293443 2:30060606-30060628 AGGGAAAACACAGTGATTCTGGG + Intergenic
928450105 2:31371067-31371089 TGGGATAGCACAATGAATGTGGG - Intronic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928715648 2:34056696-34056718 AGGAAGAGTGCCATGATTGTGGG - Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
929182620 2:39059742-39059764 GTGGAGAACACAATGATTCTTGG + Intronic
929506946 2:42535698-42535720 AGGAAGAGGAGAATGAATGTTGG + Intronic
929955970 2:46459036-46459058 AGGGAGACAACAAAGATGGTAGG - Intronic
930056790 2:47258360-47258382 AGGGAGAGCACAATGTTTCAGGG + Intergenic
930139767 2:47939623-47939645 AGTGACAGCACAAAGATTATAGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930588326 2:53296919-53296941 ATGGAGAGTACAAGGATGGTTGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
933207277 2:79521642-79521664 AGGAAGAGGTAAATGATTGTTGG + Intronic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935179688 2:100678254-100678276 AGGGAGCTCACATTTATTGTGGG - Intergenic
935402729 2:102677409-102677431 AGGGAGAGCACTATAATTAGTGG - Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
938214339 2:129496877-129496899 AGCTAGAGCACAAAGATTCTGGG - Intergenic
938640186 2:133269592-133269614 AGGGAGAGGTCAATGAGGGTAGG + Intronic
938871021 2:135476658-135476680 ATGGAGAGCTCAATATTTGTTGG - Intronic
940595085 2:155781099-155781121 AAGGAGACCACAATAATAGTGGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940905036 2:159161234-159161256 AGGGAGAGCACTTTGACTTTTGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942477121 2:176339166-176339188 AGTGAGAGCACAAAGATTATGGG - Intergenic
942653323 2:178191225-178191247 AGTGAGAGTACAAAGATGGTTGG + Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944099908 2:196013216-196013238 AGGGAGGGCTCAATGCTTCTAGG + Intronic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945066309 2:205950235-205950257 AGCGAGAACACAAAGATTCTAGG - Intergenic
945399994 2:209369944-209369966 AGAGAGAGCAAAATGAGTTTAGG + Intergenic
945727911 2:213495566-213495588 AGGGAGATTACATTGATTGAAGG + Intronic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947353893 2:229272570-229272592 AGAGAGAACACAATGTTTGTGGG + Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
947587220 2:231363919-231363941 GGGGAAGGCACCATGATTGTAGG - Intronic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1169015800 20:2291758-2291780 GGGGAGAACACAATCATTGTTGG + Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170062648 20:12275854-12275876 AAGAAGAGTACAATTATTGTAGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171470611 20:25368164-25368186 AGCAAGAGCACAAAGATTCTAGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172130212 20:32650323-32650345 CTGGGGAGCAGAATGATTGTGGG + Intergenic
1172794989 20:37530629-37530651 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1173097465 20:40049756-40049778 AAGGAAAGCACTAGGATTGTTGG - Intergenic
1173459457 20:43231343-43231365 AGCAAGAGCACAAAGATTCTAGG - Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1175320937 20:58087893-58087915 ATGGAGAGCACCATGATTTAGGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176411746 21:6452856-6452878 AGGGAGAGCCCAACGATTATGGG + Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177271832 21:18858362-18858384 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1179687240 21:43061178-43061200 AGGGAGAGCCCAACGATTATGGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1183057927 22:35318405-35318427 AGGGAGATCACAAGGATGGCAGG + Intronic
1184382837 22:44156836-44156858 ACAGAGAGCAGAATGATTGGTGG + Intronic
1185219960 22:49624261-49624283 AGGGAGGGCACAGTGATGCTCGG + Intronic
1185219995 22:49624415-49624437 GGGGAGAGCACAGTGATGCTCGG + Exonic
949251471 3:1989554-1989576 ATGGAAAGCACATGGATTGTTGG - Intergenic
950414061 3:12858330-12858352 AGAGAGAGCAAAAGAATTGTGGG + Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951125961 3:18983384-18983406 AGGGAGAGAGACATGATTGTGGG - Intergenic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951255053 3:20439051-20439073 AAGGAGAGGACAATGACTGGGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951562040 3:23977708-23977730 AGGGAGATCAAAATGGTTTTTGG - Exonic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
953658637 3:44873943-44873965 AGCGAGAGCACAAAGATTCTAGG - Intergenic
954473363 3:50719371-50719393 AGCAAGAGCACAGTGATTATAGG + Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
954724626 3:52597101-52597123 AGTTAGAGCACAGTGATTGAGGG - Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
955604809 3:60690114-60690136 AGTGAAAGCACAAAGATTCTAGG + Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
956948951 3:74257842-74257864 AGGGAGAAAACAATGGATGTGGG - Intergenic
957087239 3:75692392-75692414 ACGGAGAGCACAAGGACTGGAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959719553 3:109471218-109471240 AGCGAGAGCACAAAGATTCTAGG + Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
960840933 3:121957918-121957940 AGGGAAAGCACCGTAATTGTGGG + Intergenic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
961764931 3:129202432-129202454 AGGCAGAGCACAGAGATTTTGGG - Intergenic
962774185 3:138643406-138643428 AGTGAGAGCACAAAGATTATAGG + Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
963828798 3:149984886-149984908 AGAGATAGCACAAAGATTATAGG - Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964349690 3:155790661-155790683 GGGGAGAGTACATTGATTATGGG + Intronic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965306174 3:167066421-167066443 AGCGAGAGCACAAAGATTCCAGG - Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965415299 3:168385161-168385183 AGGGAGAGCGCACTGAATGGGGG - Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968096043 3:195931515-195931537 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096053 3:195931577-195931599 AGGCAGAGCACAGTGATGATGGG + Intergenic
968096064 3:195931639-195931661 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096075 3:195931701-195931723 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096083 3:195931763-195931785 AGGCAGAGCACAGTGATGATAGG + Intergenic
968218459 3:196914930-196914952 AGGAAGAGCAAAATGATTGTGGG + Intronic
970531951 4:16993921-16993943 ACGGAGGACACAATGAGTGTTGG + Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG + Intergenic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973839554 4:54846971-54846993 AGTGAGTGCTCAATGAATGTTGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974285756 4:59865011-59865033 AGGGAGAGCCAAATGATTCTGGG - Intergenic
974343725 4:60650169-60650191 AGGGAGGGCATAAAGAATGTTGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976082940 4:81376033-81376055 GGGGAGGGCACAGCGATTGTGGG - Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
977544609 4:98362713-98362735 AGGGAGAGAACAATAATTTGTGG - Intronic
977632137 4:99254897-99254919 AAGGAGAGTAGAATGAGTGTGGG - Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
977725983 4:100297581-100297603 AGGCAGAACAGAATGAATGTAGG - Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978733686 4:112061326-112061348 AGGGACAGCACAGTGATCATGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979111271 4:116761152-116761174 AGGGGAAGCACGGTGATTGTGGG + Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979734257 4:124063076-124063098 AGTGAGAGCACAAAGATTCTAGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982098049 4:151941486-151941508 AAGGAGAGAACAAATATTGTTGG + Intergenic
982339723 4:154284589-154284611 AGGGTGAGCATGGTGATTGTGGG + Intronic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982911454 4:161148057-161148079 AGGAAGAGTACATTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
985187256 4:187331120-187331142 AGAAAAAGAACAATGATTGTGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
987273186 5:16334791-16334813 AGGCAGAGCACAAAGATTTTAGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
988885542 5:35553618-35553640 TGGGAGAACAAAATCATTGTTGG - Intergenic
989564872 5:42892205-42892227 AGCGAGAGCACAAAGATTATAGG + Intergenic
989766551 5:45091748-45091770 AGGAAGAGCAAAATAATTCTGGG + Intergenic
989980142 5:50633697-50633719 AGCAAGAGCACAAAGATTCTAGG - Intergenic
990202965 5:53398311-53398333 AGGAAGACCATAGTGATTGTGGG - Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
991433521 5:66572641-66572663 AGCAAGAGCACAAAGATTCTAGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
992966663 5:82009488-82009510 AGCGAGAGCACAAAGATTCTAGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994287118 5:97982601-97982623 AGGGAGAGGCCATTGAATGTTGG - Intergenic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995245155 5:109927120-109927142 AGTGAAAGCACAATGATTGGGGG + Intergenic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995358671 5:111268645-111268667 ATGGAGAGAAAAATGATAGTGGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995974190 5:118010899-118010921 AGGGAGAGCAAAATCAGAGTTGG + Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
999491312 5:152054193-152054215 AGGGAGGGCTCAATTAATGTAGG - Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
999846491 5:155486674-155486696 AGTAAGAGCTCAATGAATGTTGG + Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1002201357 5:177530504-177530526 AGGGAGAGATGATTGATTGTGGG - Intronic
1005089843 6:22044876-22044898 AGTGAGAGCACCAAGACTGTGGG + Intergenic
1005931985 6:30491033-30491055 AGGAAGAGGACAATTATAGTAGG - Intronic
1006564162 6:34939975-34939997 AGTGTGAGCACAATGAATTTTGG + Intronic
1007179944 6:39922801-39922823 AGGCAGAGCAAAAGGATTGCAGG - Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010144569 6:72652387-72652409 AGGGAGAGAAAAATGAGAGTGGG - Intronic
1011322935 6:86116723-86116745 AGGAACAGCACAAGGATTGTGGG - Intergenic
1011340892 6:86313219-86313241 AGGGAGACCACAGCAATTGTAGG + Intergenic
1011359814 6:86511371-86511393 AGGGGGAGAACAGTAATTGTGGG - Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013595950 6:111661419-111661441 AAGGAAAGCACTAGGATTGTTGG + Exonic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014378651 6:120711156-120711178 ACGGAGAGTCCACTGATTGTGGG + Intergenic
1014840902 6:126219007-126219029 AGGGAAAGCATAACAATTGTGGG - Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016119011 6:140324760-140324782 ATGGAGATTACAATGATTTTAGG + Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016503566 6:144750482-144750504 AGGGTGAGAACTATGAATGTTGG - Intronic
1019844638 7:3485433-3485455 AGGGAAAGCAAAGTGAGTGTGGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1020882392 7:13778449-13778471 AAGTAGAGAACAATGATTATAGG + Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021649373 7:22818740-22818762 ATGAAGAGCAAAATGATTTTTGG + Intronic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022536512 7:31101921-31101943 AGGAAGAGGACCATGAGTGTGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1023945728 7:44801508-44801530 AGCGAGAGCACAAAGATTCTAGG - Exonic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028426786 7:90698402-90698424 AGGAAGAGCAGAATGGTGGTGGG + Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029147064 7:98454002-98454024 AGCGAGACCACAAAGATTCTAGG + Intergenic
1029652787 7:101905244-101905266 AGGAAAAGCACTATGATTTTAGG + Intronic
1029705471 7:102273619-102273641 AGGGAGAACCCAATGGTTTTAGG - Intronic
1030091402 7:105862025-105862047 AGGAAGGGCACAATGATGGAAGG + Intronic
1030362664 7:108611097-108611119 AGAGAAAGCACAAGGATTCTGGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033760796 7:144434715-144434737 AGCAAGAGCACAACGATTATAGG + Intergenic
1033814120 7:145051648-145051670 AGAGAAAGCACGGTGATTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034162279 7:149002402-149002424 AGGGAGGGCACGATGGTTGGGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034946863 7:155267816-155267838 AGGGAGAAGACCATCATTGTGGG - Intergenic
1035138980 7:156738175-156738197 AGGGAGAGCACAACAAATGGGGG + Intronic
1035264410 7:157683289-157683311 AGAGCTTGCACAATGATTGTCGG + Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1036011990 8:4736345-4736367 AAGGAGATCACAATGGTTGGAGG + Intronic
1038097511 8:24331296-24331318 TGGGAGAGGACTGTGATTGTGGG + Exonic
1038559046 8:28553679-28553701 TGGAAGATCACAATGACTGTTGG - Intronic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1040336735 8:46419881-46419903 AGCGAGACCACACTGAATGTTGG + Intergenic
1041497632 8:58504141-58504163 AGCAAGAGCACAAAGATTATAGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1042110693 8:65378204-65378226 AGCAAGAGCACAAAGATTATAGG - Intergenic
1042162520 8:65911820-65911842 AGGGAGTGCACAATGACTAGAGG + Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043567203 8:81561639-81561661 AAGGAGGGCACGGTGATTGTGGG + Intergenic
1044124165 8:88437342-88437364 AGGGAGAGCCCAGCGATTCTGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047352540 8:124089311-124089333 AGGAAGAACACAATAATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG + Intergenic
1050634656 9:7598463-7598485 AGCGAGAGCACAAACATTCTAGG - Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051047085 9:12888238-12888260 AGGGAGAGCATAATTACTGGGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1053285730 9:36848498-36848520 AGGGAGAGCCCGATGACAGTGGG + Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055464308 9:76549171-76549193 AGTGAGAACACAAAGATTATAGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1058086284 9:100752028-100752050 AGGGGTTGCACAGTGATTGTGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059069202 9:111117770-111117792 ATGGAGAGCATAATGTTAGTAGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1187132591 X:16517163-16517185 AGAGACAGCCCAATGATTGTGGG + Intergenic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188421225 X:29992518-29992540 AGGGAGGGCATAGTAATTGTGGG - Intergenic
1188609004 X:32072475-32072497 AGAAAGAACACAATGACTGTGGG - Intronic
1188698263 X:33224584-33224606 AGGCAGAGCACAAATATTTTAGG + Intronic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189109385 X:38271597-38271619 GGGTAGACCACAATGTTTGTAGG - Intronic
1189119414 X:38378261-38378283 AAGGAAGCCACAATGATTGTGGG - Intronic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1191069578 X:56385762-56385784 AGGGTGTGCACAATGAGTTTTGG + Intergenic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1192065289 X:67878842-67878864 AGAGAGAACACAAAAATTGTAGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193750513 X:85337271-85337293 AGGGAGAGCAAGGTGAGTGTGGG - Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1193931694 X:87561371-87561393 GGGGAAAGCAAAGTGATTGTAGG + Intronic
1194086667 X:89536675-89536697 AGGGAGAGCTCAAAGAATATCGG - Intergenic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195018337 X:100800188-100800210 AATGAGAGCACAAAGATTATAGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196189307 X:112778467-112778489 AGGGTGAGGACAAGGGTTGTGGG - Exonic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197053802 X:122093477-122093499 GGGAAGAGCACAGCGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199751145 X:150819333-150819355 AGTGAGTGCACAAAGATTATAGG - Intronic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic
1201390733 Y:13494451-13494473 AGGGAGAGCACAAGCAGGGTGGG + Intergenic
1201760901 Y:17537086-17537108 AGGAAGAGCACAATGACTGAAGG - Intergenic
1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG + Intergenic