ID: 1079533550

View in Genome Browser
Species Human (GRCh38)
Location 11:21484288-21484310
Sequence TGGTGGTTTCTCGGGGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079533550 Original CRISPR TGGTGGTTTCTCGGGGCATA AGG (reversed) Intronic
900612363 1:3549511-3549533 TGGGGGCTTCTGGGGGCACATGG + Intronic
901796631 1:11683231-11683253 TTGTGTTTTCTCAGGGCAGAGGG - Intronic
905032768 1:34898985-34899007 TGGTGGTTCCTCAGGACAGAGGG + Intronic
905944672 1:41891433-41891455 TGGTGGTGTCACGGGGCAGAAGG + Intronic
906711076 1:47930346-47930368 TTGGGGTTTCTCTGGGCATCTGG + Intronic
906889946 1:49699720-49699742 TGGTGGTTACCAGGGGCAGATGG + Intronic
907816983 1:57928246-57928268 TGGTTGCCTCTCGGGGGATAGGG - Intronic
909296880 1:73961434-73961456 TTGTTGTGTCTCGGGGAATAAGG - Intergenic
910118190 1:83755974-83755996 TGGTGGTGTCTTGGGGCTTGAGG + Intergenic
910207239 1:84760058-84760080 TGCTGCCTTCTCGGGGCTTAGGG - Intergenic
914737821 1:150435255-150435277 TTGTGGTGTCTCAGGGAATAAGG - Intronic
919756263 1:201067990-201068012 TGGTGGGCTCTGGGGGCAGAAGG - Intronic
1071521576 10:86334655-86334677 TGCTGGGTTCTGGGGACATAGGG + Intronic
1072286685 10:93922425-93922447 TGGTGGTTGCCAGGGCCATATGG + Intronic
1074474059 10:113753717-113753739 TGGTGGTTTGTCAGAGCATTTGG - Intronic
1074813686 10:117128920-117128942 TGGTGGTTTCTCAGGTCTCAGGG - Intronic
1075414260 10:122250568-122250590 TGGTGGTCTCTAGGGGCATTTGG + Intronic
1078012131 11:7580487-7580509 TGGTGGTGTCTCAGGGCAAAGGG + Intronic
1079533550 11:21484288-21484310 TGGTGGTTTCTCGGGGCATAAGG - Intronic
1080719460 11:34835310-34835332 TGGTGGTTTCCAGGGACTTAGGG + Intergenic
1082102077 11:48180961-48180983 TGGTGGATTCACGGGGCTGACGG + Intergenic
1084418239 11:69046696-69046718 TGGTGGTTTCCAGGGGCTGAGGG + Intergenic
1084738879 11:71125128-71125150 TTATTGTGTCTCGGGGCATAGGG - Intronic
1089310324 11:117554129-117554151 TGGTGGTTTCCAGGGGCTGAGGG + Intronic
1090002508 11:122974847-122974869 TGGTGGTTTCTTGGTGGATTAGG - Intergenic
1091286220 11:134410044-134410066 TAGTGGTTTCTCGGGGATAAGGG - Intronic
1093687018 12:22068369-22068391 TTGTTGTGTCTCGGGGAATAGGG + Intronic
1097552053 12:61085276-61085298 TGGTGGTTGCTAGGGGCTTGAGG + Intergenic
1100942088 12:99734631-99734653 TGGTGGTTTGTGGAGGCATCAGG - Intronic
1108230433 13:48333702-48333724 TGCTTGTTTCTCTGAGCATATGG + Intronic
1114660872 14:24343401-24343423 TGGTGGTTTGTAGGGGCTGAGGG + Intergenic
1114935683 14:27533721-27533743 TGGAGGTTTCACAGGGCATTGGG - Intergenic
1116535917 14:46029805-46029827 GGGTAGTTTCTAGGGGCAAAAGG - Intergenic
1118620504 14:67610170-67610192 AGGTGGTTTCTCAGGGAATGTGG - Intergenic
1119621024 14:76131829-76131851 TGGTGGTCTCTCGGGGCAAGGGG + Intergenic
1120245852 14:82005472-82005494 TGGTGGTTTCCAAGGGCAAAGGG - Intergenic
1121242835 14:92442311-92442333 TGGTGGTTTCTTGGGGCATGTGG + Intronic
1123011409 14:105351179-105351201 TGCTTGTTTCTCGGGGCACGAGG + Intronic
1124427878 15:29577906-29577928 TGGTAGTTGCTAGGGGCAGAGGG + Intergenic
1128028805 15:64461237-64461259 TGGTGGTTGTTCAGAGCATAGGG + Intronic
1128388801 15:67168899-67168921 TGGTAGTGTCTCGGGCCAGAGGG + Intronic
1130070366 15:80642005-80642027 AGGTGGGTTCCCTGGGCATAGGG + Intergenic
1130338869 15:82981825-82981847 TGGTGGTTGCTAGGGGCAGAGGG + Intronic
1137605824 16:49786267-49786289 TGGTTGTTTCTGGGGGCGGAGGG + Intronic
1138936686 16:61734949-61734971 TGGAGGCTTCTCAGGGCATGTGG - Intronic
1141116424 16:81313907-81313929 TGGAGGTTGCTCAGGGCACATGG - Intergenic
1144540237 17:16134302-16134324 TGGTTGTTTCACGGGGAATTTGG - Intronic
1145737669 17:27244513-27244535 TCGAGGTTTCTCGGCACATAGGG - Intergenic
1150124249 17:62626676-62626698 TCTTGGGGTCTCGGGGCATAGGG - Intergenic
1150933317 17:69609165-69609187 TTGTGGTTTCTTGTGGCATTTGG - Intergenic
1153175438 18:2367014-2367036 TGGTTGTGTCTCAGGGAATAAGG - Intergenic
1154358667 18:13641818-13641840 TGCTGGTTTTTCGGGAAATAAGG + Intronic
1155692241 18:28639330-28639352 TGGTGGTTTCTGGAGGCTTGGGG - Intergenic
1156364678 18:36414789-36414811 AGGGGGTTTCTGGGGGCACAGGG + Intronic
1157159885 18:45304302-45304324 TGTGGGTTTCTCATGGCATAGGG + Intronic
1160520288 18:79504364-79504386 TGGTTGTGTCTCAGGGAATAGGG + Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
929525071 2:42693933-42693955 TGCTGGTTACTCGGGGCCCATGG + Intronic
943525602 2:189013205-189013227 TGGTGGTTTCCAAGGGCAGAAGG + Intergenic
943915626 2:193628255-193628277 TGCTGGTTATTCGGGGCACAGGG - Intergenic
946157856 2:217818625-217818647 TGGTAGTTTCTCTGGGCAGACGG + Exonic
948397860 2:237661037-237661059 TGTTAGTTTCTCGGGGCACAGGG - Intronic
1170257803 20:14364622-14364644 TGGTGGTTTCTGGGAGCTAAGGG - Intronic
1170583636 20:17717302-17717324 TGGAGTGTTCTCAGGGCATAGGG + Intronic
1171247716 20:23626012-23626034 TGGTGGTTTCTCAGGTGATGCGG + Intergenic
1172090649 20:32429752-32429774 TGGTGGTTTCTCTCAGCCTAAGG + Intronic
1173316328 20:41947907-41947929 TGGTGATTTCTAGGGACAGAAGG + Intergenic
1176117008 20:63437093-63437115 TCGTGGTTTCCCAGTGCATATGG - Intronic
1178591776 21:33916805-33916827 TGTTGGTTTGTGAGGGCATATGG + Intergenic
1179147483 21:38781057-38781079 TGGTGGTTTCCAGGGGCTGAAGG - Intergenic
1180113285 21:45676663-45676685 TTGTTGTGTCTCAGGGCATACGG - Intronic
1180987622 22:19914621-19914643 TGGTGGTTTCTAGGGGCTGGGGG + Intronic
1181347671 22:22231875-22231897 TGGTGGTTTCCAGGGGCTGAGGG + Intergenic
1182428844 22:30288843-30288865 CGGGGGTGTCTCGGGGCAGATGG - Intronic
1183600990 22:38840569-38840591 GGATGGTTTCTCAGGGCACATGG + Intronic
950146371 3:10652916-10652938 TGGTGGTTCCTGGGGGCTTGGGG + Intronic
950497263 3:13341202-13341224 TGGGGCTGTCTCGGGGCATTAGG - Intronic
951092924 3:18596892-18596914 TGGTGCATTCTGGGGGCATGGGG + Intergenic
951279570 3:20731724-20731746 TGGTGGTTTTTCAGGGCCCAAGG + Intergenic
953170607 3:40503553-40503575 TGGTGGTTTCTTGGGGCTGGAGG - Intergenic
953678272 3:45020254-45020276 TGGTGGTTTCCAGGGGCTTGGGG - Intronic
955084385 3:55688468-55688490 TTGTGGCTTCTCGGCTCATATGG - Intronic
955299940 3:57768582-57768604 TGGTGGTTTCTAGGGGCTGAGGG + Intronic
959808800 3:110592269-110592291 TGGTGGGTTCTCGAGGCTTTGGG + Intergenic
960429504 3:117551552-117551574 TGGTGGAGTCTTGGGGCACAAGG - Intergenic
961152865 3:124654352-124654374 TGGTGGCTTCTGGGGCTATACGG + Intronic
963249902 3:143093703-143093725 GGCTGGTTTCTCTGGGCAGAGGG + Intergenic
963584497 3:147167450-147167472 TTGTTGTTTCTCAGAGCATAGGG + Intergenic
967922460 3:194623359-194623381 TGGCTGTTTCTTGGGGCACATGG - Intronic
970654302 4:18214080-18214102 TGGTGGTTTCCAGGGGCAGAAGG + Intergenic
973763216 4:54139769-54139791 TGGTGGTTATTCAGGGCCTAGGG - Intronic
973881506 4:55276532-55276554 TGATGGTTACTAGGGGCTTAGGG - Intergenic
981218803 4:142206964-142206986 TGGTGGTTTCCAGGGGCTTCGGG - Intronic
983207164 4:164922647-164922669 TGATGATTTCTTGGGGCATAAGG - Intergenic
985711673 5:1433020-1433042 TGGGGGTCTCTGGGTGCATAAGG - Intronic
988150594 5:27373617-27373639 TGGTGGTTTCAGGAGGCAGAAGG - Intergenic
994407284 5:99360303-99360325 TGGTGGTTTCTGGGAGCTGAGGG + Intergenic
996446627 5:123560789-123560811 TGGTGTTTTCTGGGGGCTTGGGG + Intronic
1000216715 5:159165256-159165278 TAGTGGTTTCGTGGGGCAGAGGG - Intronic
1005605743 6:27475339-27475361 TGGTGGTTGCCAGGGGCTTAGGG + Intergenic
1006645793 6:35513095-35513117 TGGGGGCTTCTCGGGGCAGGTGG - Intergenic
1008049701 6:46887767-46887789 TGATGGTTTCTGGAGACATAGGG + Intronic
1012963974 6:105652894-105652916 TAGTGGTTTCCAGGGGCTTAGGG - Intergenic
1013722823 6:113051307-113051329 TGGAGCTTTCTCGGGACATCAGG + Intergenic
1017104161 6:150872433-150872455 TTGTTGTTTCTCAGGGAATAGGG + Intronic
1017911618 6:158797994-158798016 TGGTGGTTTCCAGGGGCTGAGGG - Intronic
1021113954 7:16727758-16727780 TGGTGGTTTCCAGGGGCTGAGGG - Intergenic
1021747038 7:23751947-23751969 TGGTGGTTTCTGGGGGCTTGGGG + Intronic
1023104402 7:36749414-36749436 TGGTGGTTTCCAGGGGCTTGGGG + Intergenic
1027996092 7:85427081-85427103 TGGTGGTTACTCAGGGCCCAGGG - Intergenic
1028690848 7:93647990-93648012 TTGTGGTTTCTCAGGGCTGACGG + Intronic
1030834625 7:114266611-114266633 GGGAGGTGTCTGGGGGCATAAGG - Intronic
1031860220 7:126970865-126970887 TTGTTGTGTCTCAGGGCATAGGG + Intronic
1039362225 8:36889164-36889186 TGGTAGTTTTGCTGGGCATATGG - Intronic
1041619166 8:59945320-59945342 TGGTGGTTTCTAGAAACATATGG + Intergenic
1041650961 8:60302231-60302253 TTGTGTTTTCTTTGGGCATATGG - Intergenic
1041987589 8:63943739-63943761 TTGTTGTTTCTCGGGGAAGAGGG + Intergenic
1048476671 8:134749015-134749037 TGCTCATTTCTCGGGGCAAATGG + Intergenic
1050140142 9:2509263-2509285 TAGTGGTTTCCAGGGGCTTACGG - Intergenic
1050175820 9:2868501-2868523 TGGTGGATTCTAGGGGAATTTGG - Intergenic
1052021922 9:23535034-23535056 TTGTGATTTCTGGGGGCAGAAGG + Intergenic
1053465625 9:38306046-38306068 TGGTTGTGTCTCAGGGAATAGGG + Intergenic
1059487998 9:114642206-114642228 TGGTGGTTTCTAGGGGTTGAGGG - Intronic
1061390836 9:130316295-130316317 TGGAGGTGTCTAGGGGCAGATGG + Intronic
1062432342 9:136531771-136531793 TGGTGGTTTCCCGGGACAGGCGG - Intronic
1062488643 9:136793434-136793456 TGGTGGTGTCACGTGGCCTACGG - Intronic
1185955086 X:4480330-4480352 TGGTGGTTACTAGGGGCTGAAGG + Intergenic
1186044715 X:5522997-5523019 TGTTACTTTCTCTGGGCATAGGG - Intergenic
1187033759 X:15515758-15515780 TGGTGTTTTCTTGTGGCAGAAGG - Intronic
1190112979 X:47606976-47606998 TGGTGGATTCTCTGTGGATATGG - Exonic
1190482985 X:50896312-50896334 TTGTTGTGTCTCGGGGAATAAGG + Intergenic
1191131574 X:57018245-57018267 TGTAGGTTTCTTTGGGCATATGG + Intergenic
1191197134 X:57736651-57736673 TGTTGGTTTTTCAGGGCACAAGG - Intergenic
1191899046 X:66022499-66022521 TGGTGGGCTCTTGGGCCATAGGG - Exonic
1193692803 X:84668101-84668123 TGGTGGTTTTTCGGGGCCCAAGG - Intergenic
1196777189 X:119349842-119349864 TGGTGGTTGCCAGGGGCTTATGG + Intergenic
1197616652 X:128699579-128699601 TGGTGGTTACTAGGGGTAAAGGG - Intergenic