ID: 1079533658

View in Genome Browser
Species Human (GRCh38)
Location 11:21485405-21485427
Sequence TTGGAGGCCTGCCACTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079533658_1079533668 28 Left 1079533658 11:21485405-21485427 CCTCCTCAGTGGCAGGCCTCCAA 0: 1
1: 0
2: 1
3: 24
4: 187
Right 1079533668 11:21485456-21485478 TAGAGGACTGTGTCCTCCACTGG 0: 1
1: 0
2: 1
3: 10
4: 116
1079533658_1079533669 29 Left 1079533658 11:21485405-21485427 CCTCCTCAGTGGCAGGCCTCCAA 0: 1
1: 0
2: 1
3: 24
4: 187
Right 1079533669 11:21485457-21485479 AGAGGACTGTGTCCTCCACTGGG 0: 1
1: 0
2: 1
3: 13
4: 171
1079533658_1079533664 11 Left 1079533658 11:21485405-21485427 CCTCCTCAGTGGCAGGCCTCCAA 0: 1
1: 0
2: 1
3: 24
4: 187
Right 1079533664 11:21485439-21485461 TCCAAGTTCACAGCCCTTAGAGG 0: 1
1: 0
2: 1
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079533658 Original CRISPR TTGGAGGCCTGCCACTGAGG AGG (reversed) Intronic
900159065 1:1214973-1214995 TTGGAGACAGGCCTCTGAGGAGG + Intergenic
900375077 1:2350554-2350576 TGGGAGGCCTGTCCCTGGGGTGG + Intronic
902125867 1:14210463-14210485 TTGGATGCCTGCTACAGTGGAGG + Intergenic
902712334 1:18249064-18249086 TTGGAGGCCAGACAGGGAGGAGG + Intronic
903742379 1:25565739-25565761 TTGGGGACATGCCACTGAGAAGG + Intronic
903814949 1:26058096-26058118 CTGTAGGCCAGGCACTGAGGTGG - Intronic
905436599 1:37960116-37960138 ATGGCAGCCTGACACTGAGGTGG - Exonic
907061548 1:51431388-51431410 TTTGGGACCTGCCACTAAGGGGG - Intronic
907714881 1:56917272-56917294 TTGCAGAGCTGCTACTGAGGAGG - Intronic
909800119 1:79796613-79796635 GGGCGGGCCTGCCACTGAGGTGG + Intergenic
910327837 1:86030314-86030336 TTGGAGGCCACCAACTGGGGTGG + Intronic
912415595 1:109506515-109506537 ATGGATGCCTGCCACAGACGTGG - Exonic
912491695 1:110066032-110066054 GTGGAGGCCTGGCCCTGAGGAGG + Intronic
918074434 1:181159671-181159693 GAGGAGGCCAGCCACTGGGGAGG - Intergenic
920457619 1:206113160-206113182 CTGGAGACGTGCCACAGAGGAGG + Intronic
922132384 1:222792640-222792662 TTGGCTGCCTGCCACTGTGCTGG + Intergenic
922228520 1:223666055-223666077 TTGGAGGCATGGCTCTGAGCAGG + Intergenic
922991242 1:229913683-229913705 TTGGAGCCCTGCCAATGGTGGGG + Intergenic
1063655580 10:7985305-7985327 ATGGAGGCCAGCAGCTGAGGAGG - Intronic
1069065804 10:63940772-63940794 TTTTAGCCCTGCCACTGATGAGG - Intergenic
1069068746 10:63973425-63973447 GTTGAGGACTGCCACTGCGGAGG - Intergenic
1071493519 10:86152586-86152608 TTTGGGGCCTGCCACAGGGGAGG + Intronic
1072052425 10:91718878-91718900 TTGGGGGTCTGCCTCTGATGTGG - Intergenic
1076634655 10:131874284-131874306 TTGGAGGGCAGCCCCCGAGGAGG + Intergenic
1077500165 11:2905948-2905970 TGGGAGCCCTGCCCTTGAGGAGG + Intronic
1077601845 11:3580153-3580175 TTGCTGGCCTTCCACTGAGGAGG - Intergenic
1078279676 11:9888380-9888402 TTGCAGTCCTGCTACTGAGGAGG + Intronic
1079533658 11:21485405-21485427 TTGGAGGCCTGCCACTGAGGAGG - Intronic
1080645286 11:34183584-34183606 AGGGAGGCCTGCTTCTGAGGGGG - Intronic
1081691336 11:45080507-45080529 TTAGAAGCCTGCCACTGGAGAGG - Intergenic
1083596038 11:63918639-63918661 ATGGCGCCCTGCCACTTAGGAGG - Intergenic
1084257759 11:67954699-67954721 TTGCTGGCCTTCCACTGAGGAGG - Intergenic
1084707129 11:70822080-70822102 TTGGAGGGCTGCCTTTCAGGAGG - Intronic
1084815010 11:71640538-71640560 TTGCTGGCCTTCCACTGGGGAGG + Intergenic
1085593701 11:77789638-77789660 TTGGGGCCCTGCCACTGTGGAGG - Intronic
1086121765 11:83312094-83312116 TTGGAGCCCTGACACTGACCTGG + Intergenic
1087094319 11:94305423-94305445 TTGGAGGCCTGACACAGTGCTGG - Intergenic
1091268327 11:134288024-134288046 TTGGAGCCCAGCCACAGAGAAGG - Intronic
1092427989 12:8389496-8389518 TTGCTGGCCTTCCACTGAGGAGG - Intergenic
1095872104 12:47040072-47040094 TTTGGGGCCAGCCACTGAAGTGG + Intergenic
1096413287 12:51391987-51392009 CCGGAGGCCTGCCCCGGAGGGGG + Intronic
1096795563 12:54075507-54075529 GTGGAGGCCTGGCAGTAAGGGGG - Intergenic
1097685492 12:62687119-62687141 ATGGAGTTCTGCCACTGATGTGG - Intronic
1102112597 12:110376026-110376048 TTGGGGGAAGGCCACTGAGGAGG - Intronic
1103735468 12:123058181-123058203 TTGTAGGGCTGCCAGGGAGGTGG + Intronic
1106263851 13:28092259-28092281 CTGGAGGTTTGCCACTGAGGAGG - Intronic
1107357551 13:39583965-39583987 GTCGAGGCCTGACACGGAGGAGG - Intronic
1107951880 13:45470261-45470283 TTGATAGCCTGCCCCTGAGGAGG + Intronic
1109618247 13:64865271-64865293 TTTGAGTCCTGCCACTTAGGAGG + Intergenic
1116436252 14:44897738-44897760 CGGGAGGCCTGGCACCGAGGCGG - Intronic
1118000964 14:61523132-61523154 TTTGCTGCCTTCCACTGAGGAGG - Intronic
1121255164 14:92525574-92525596 TAGGAGGCCTGCCAGGGTGGAGG + Intronic
1122473964 14:101992840-101992862 AAGGAGACCAGCCACTGAGGTGG - Intronic
1122618147 14:103035452-103035474 TGGGAGGCCTGCCAGGCAGGAGG + Intronic
1124202624 15:27691351-27691373 TAGGAGGTCAGCCACAGAGGAGG - Intergenic
1127410113 15:58697334-58697356 GTGGGGCCCTGCCACTGGGGAGG - Intronic
1128099864 15:64989816-64989838 CGGGAGGCCGGCCTCTGAGGGGG + Exonic
1130152537 15:81322453-81322475 TTGGAGGCCTACGAGTGAAGTGG - Exonic
1131265200 15:90911511-90911533 CTGGAGCTCTGCCACCGAGGCGG + Exonic
1133370255 16:5240871-5240893 TTGCTGGCCTTCCACTGGGGAGG + Intergenic
1133751062 16:8725891-8725913 TTGGAGGGCACCCACTGGGGTGG - Intronic
1134126774 16:11621568-11621590 ATGGAGGCCTGCTTCTGAGGGGG - Intronic
1134139258 16:11703009-11703031 GAGGAGGCCTGGCACTGAGTAGG + Intronic
1138198813 16:55073985-55074007 CTGCAGTCCTGCTACTGAGGAGG + Intergenic
1139056053 16:63185762-63185784 TTGTAGGCCTGTCACTGGGGTGG + Intergenic
1142251634 16:88994488-88994510 ATGGATGCCTGGCACTGAGGGGG - Intergenic
1147317887 17:39629523-39629545 TTGGTGGCCTTCCTCAGAGGAGG + Exonic
1147650678 17:42060100-42060122 ATGGAGGGCTGACACTGAGTGGG - Intronic
1147755300 17:42763293-42763315 CTGGGGGCCTGCAACTGGGGAGG + Intergenic
1148588033 17:48794731-48794753 TTGGAATGCTGCCACTGAGGGGG + Intronic
1148634150 17:49134113-49134135 TGGGAGGCCTGATACTGATGCGG + Intronic
1150392574 17:64798488-64798510 GTGGAGGCCAGGCTCTGAGGGGG - Intergenic
1151150163 17:72078053-72078075 TTGAAGCCCAGCCTCTGAGGGGG - Intergenic
1151577143 17:74958548-74958570 TTGGAGGCCTCCCTCCTAGGAGG + Intronic
1157329450 18:46692836-46692858 ATGGTGGCCTGTCAGTGAGGAGG - Intronic
1159147305 18:64470395-64470417 TTGGAGTGCTGCCTCTGAGCTGG - Intergenic
1160012455 18:75116387-75116409 TTGCAGGCCTGGCTCTGGGGCGG + Intergenic
1160434704 18:78838384-78838406 ATGGAGGCCTGCCTTTCAGGTGG - Intergenic
1164311230 19:24048260-24048282 TTAGAGGCCGGCCACTGAGGTGG + Intronic
1164348724 19:27303787-27303809 TTGGAGGCCTGCAGCTGAAAAGG + Intergenic
927168118 2:20345427-20345449 ATGCTAGCCTGCCACTGAGGTGG - Intronic
927206560 2:20614915-20614937 TGAGAGGCCAGCCACAGAGGAGG + Intronic
927866475 2:26591161-26591183 CCAGAGGCCTGCCACTGGGGTGG - Intronic
928978262 2:37111734-37111756 CTGTAGTCCTGCTACTGAGGGGG + Intronic
930026686 2:47033482-47033504 AGGGAGGCCTGCCACAGGGGAGG + Intronic
932075126 2:68655531-68655553 TGGGATGCCTGCCACCGAAGAGG + Exonic
935337821 2:102033598-102033620 TTGCAGGCATGCCAAGGAGGAGG - Intergenic
937465685 2:122131323-122131345 CTGCAGGCCTTCCACTGGGGAGG + Intergenic
937638669 2:124187002-124187024 TTTGGGGCCTGACACTTAGGAGG + Intronic
937769019 2:125696733-125696755 TTGGATGCTTGCCACTGAAATGG - Intergenic
939146887 2:138426210-138426232 TTAGAGGCCTGCCCCTGGGAGGG - Intergenic
939694288 2:145305016-145305038 GTGGAGGGCTGCCACGGAAGGGG - Intergenic
939818861 2:146930863-146930885 TTGGTGGCCTGCCAGTGTGCTGG - Intergenic
939996536 2:148925828-148925850 CTGGTGGCCTGCCAGTGATGAGG + Intronic
943575282 2:189624777-189624799 TTGGCTGCCTACCACTGAGCAGG - Intergenic
947662840 2:231882735-231882757 TTGGCGGCCTCCCACTGGGGAGG - Intergenic
947989477 2:234475426-234475448 TTGGAGGCCTGGCCTTAAGGAGG - Intergenic
1169605738 20:7316858-7316880 TTGGAAGCCAAACACTGAGGAGG - Intergenic
1172103874 20:32503753-32503775 TTGGAGGTCTGCCATTGGGGAGG - Intronic
1172316370 20:33958092-33958114 TTGGAGGCCAGGCACGGTGGTGG - Intergenic
1172763728 20:37339706-37339728 ATGGAGGCATTCCATTGAGGTGG + Intergenic
1173174549 20:40754560-40754582 TGGGAGCCCTGCCAGGGAGGAGG - Intergenic
1173994379 20:47326506-47326528 TAGGAGACCCGCCACTGAGATGG + Intronic
1174582672 20:51583437-51583459 CAGGAGGCCTCCCTCTGAGGTGG + Intergenic
1175544726 20:59770959-59770981 CTGGCAGCCTGCCCCTGAGGTGG + Intronic
1176613564 21:9008830-9008852 TTGGAGGCCCCACACTGTGGGGG + Intergenic
1178518365 21:33266951-33266973 AGGGAGGGCTGGCACTGAGGGGG - Intronic
1180215870 21:46323668-46323690 GTTGAGGCCTACCACGGAGGAGG - Exonic
1180833125 22:18916221-18916243 TTGGAGGCCAGTCCCTCAGGAGG - Intronic
1181774250 22:25148240-25148262 TGGGAGGGCTGGGACTGAGGGGG - Intronic
1183394847 22:37565939-37565961 ATGGAGGCCTCCAACTGACGCGG - Intronic
1184010560 22:41744964-41744986 CTGGAGGCATGGCCCTGAGGTGG - Exonic
1184321506 22:43745319-43745341 CTGGAGGCCTGGCACTAACGTGG + Intronic
1184906382 22:47489174-47489196 CTGGAGACCTGCCCCAGAGGTGG + Intergenic
1203283209 22_KI270734v1_random:141525-141547 TTGGAGGCCAGTCCCTCAGGAGG - Intergenic
951110289 3:18795254-18795276 TAGGAGGCCAACCACTAAGGAGG + Intergenic
955952418 3:64255694-64255716 CTGGAATCCTGCTACTGAGGAGG - Intronic
956068361 3:65420382-65420404 TGGCAGGCCTGGCAGTGAGGGGG - Intronic
957526060 3:81380116-81380138 CTGAAGGCCTGCCACTGGTGAGG - Intergenic
960038313 3:113124083-113124105 TTGCAGGCTTCCCACTGAGAAGG + Intergenic
960239431 3:115323050-115323072 TTGAAGACCTGCCACCGGGGAGG - Intergenic
961281386 3:125767564-125767586 TTGCTGGCCTTCCACTGAGGAGG + Intergenic
961551479 3:127672665-127672687 TTTGAGGCCTGCCCCTCGGGCGG - Exonic
961872978 3:130002015-130002037 TTGCTGGCCTTCCACTGGGGAGG - Intergenic
962994394 3:140611176-140611198 TTGCAGGCCTGTGACTGAAGAGG - Intergenic
963729749 3:148959788-148959810 TTGGAGGGTTTCCACTGAGCAGG + Intergenic
964506637 3:157406812-157406834 TTGTAGGTCTGGCACAGAGGAGG + Intronic
966812018 3:183855381-183855403 TGGGAGGCCTGGCACTTAGGAGG - Intronic
966818435 3:183907391-183907413 TTGGGGGCCTGGCATTCAGGAGG + Intergenic
969016285 4:4106497-4106519 TTGCTGGCCTTCCACTGGGGAGG - Intergenic
969318153 4:6394652-6394674 ATGGAGGCCTGACACTGATGCGG + Intronic
969737662 4:9001827-9001849 TTGCTGGCCTTCCACTGAGGAGG + Intergenic
975404733 4:73976517-73976539 TTGAGGGCTTGCCACTGAAGAGG + Intergenic
975562911 4:75724485-75724507 TAGGAGGCGTGCCCCTGCGGTGG + Intronic
978371532 4:108034140-108034162 CTGGAGGCCTGCCTCTGATGTGG - Intronic
978615800 4:110593901-110593923 TTGTAGCCCAGCCACTCAGGAGG + Intergenic
978619673 4:110626139-110626161 TTGGTGTCCTGCCACACAGGGGG - Intronic
982171134 4:152662795-152662817 TGGGAGTCCAGCCACTGTGGAGG + Intronic
983385122 4:167051748-167051770 TTGCAGTGATGCCACTGAGGTGG + Intronic
984765656 4:183398589-183398611 GTGGAAGCCAGCCACTAAGGCGG - Intergenic
985105195 4:186492784-186492806 TTAGTGGCCTGACTCTGAGGAGG + Intronic
985820058 5:2153542-2153564 TTGAAGGCCTGCCACAGTCGAGG - Intergenic
994107429 5:95962187-95962209 TTGGAGCCCCGCCCCTGTGGGGG + Intergenic
994871882 5:105362222-105362244 CTGTGGGCCTGCCACTGGGGAGG - Intergenic
995031894 5:107490545-107490567 ATGCAGGCCTGCCAGCGAGGGGG + Intronic
997583461 5:135031204-135031226 TTGGAGGGCTGCAGCAGAGGCGG + Intronic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
999359535 5:150971490-150971512 TTGGAGGCCTGCCCCTCATGGGG - Intergenic
1002692102 5:181057421-181057443 TTCCAGGGCTGCCACTGATGTGG + Intronic
1004115768 6:12766179-12766201 TTGAAGGACAGCCTCTGAGGTGG - Intronic
1004189845 6:13454489-13454511 TTGGGGGCATGCCAGTGAGTTGG - Intronic
1008035012 6:46735829-46735851 TGGAAGGCCTGCCACTGTGCTGG + Intergenic
1009059042 6:58375270-58375292 GTGCAGGCCTGCCACAGGGGTGG - Intergenic
1009231804 6:61071853-61071875 GTGCAGGCCTGCCACAGGGGTGG + Intergenic
1011736193 6:90313158-90313180 ATGGATGCCTGCCTGTGAGGTGG + Intergenic
1015503168 6:133953565-133953587 CTGGAGGGCAGCCGCTGAGGTGG + Intronic
1015740644 6:136449896-136449918 TTGGAGGCCAGGCACGGTGGCGG + Intronic
1016845954 6:148568920-148568942 GTGGAGCCCTGGCACGGAGGAGG + Intergenic
1017097068 6:150813715-150813737 TTGGAGTCCTGCCTTAGAGGTGG + Intronic
1019117257 6:169775004-169775026 TTGGACACCTGCCATTGAGAGGG - Intronic
1020260783 7:6529729-6529751 TTGCTGGACTGCCACTCAGGGGG - Intronic
1021746407 7:23745401-23745423 TTGCAGCCCTGTCACTGGGGAGG + Intronic
1025031316 7:55559426-55559448 TTAGAGTCCTTCCACTGTGGTGG - Intronic
1025708960 7:63890619-63890641 GTGGAGGCCTCCAGCTGAGGGGG - Intergenic
1026616332 7:71908186-71908208 GTGGAGGCCTGCAACAAAGGGGG - Intronic
1027047789 7:75002651-75002673 TTGGAGGCATGAGACTGTGGAGG + Intronic
1029385205 7:100238995-100239017 TTGGAGGCATGAGACTGTGGAGG - Intronic
1034533392 7:151711920-151711942 TTGGTGGCCTGCCACCGACTGGG + Intronic
1035046827 7:155973294-155973316 GGTGAGGCCTGCCAGTGAGGTGG - Intergenic
1036242762 8:7093087-7093109 TTGCTGGCCTTCCACTGGGGAGG + Intergenic
1036258045 8:7220941-7220963 TTGCTGGCCTTCCACTGGGGAGG - Intergenic
1036310095 8:7679537-7679559 TTGCTGGCCTTCCACTGGGGAGG - Intergenic
1036359441 8:8066565-8066587 TTGCTGGCCTTCCACTGGGGAGG + Intergenic
1036829971 8:12014057-12014079 TTGCTGGCCTTCCACTGGGGAGG - Intronic
1036891514 8:12600387-12600409 TTGCTGGCCTTCCACTGGGGAGG - Intergenic
1036899057 8:12658351-12658373 TTGCTGGCCTTCCACTGGGGAGG - Intergenic
1037993963 8:23339624-23339646 TAGGAAGCCTGCCAGGGAGGGGG + Intronic
1043116047 8:76255137-76255159 TTGCAGCCCTGCTACTAAGGAGG - Intergenic
1043258571 8:78167790-78167812 GTGGTGGCCAGCAACTGAGGAGG - Intergenic
1045060106 8:98403606-98403628 TTTGAGGGCTGCCCCTGGGGAGG + Intronic
1047886954 8:129261862-129261884 TTGTAGACCTGCCAATGAGGAGG + Intergenic
1049455268 8:142683371-142683393 TTGGAGGCCTCACCCTGAGCAGG - Intergenic
1051201733 9:14633862-14633884 TTGCAGCCCTGCTACTGGGGAGG - Intronic
1053016408 9:34664875-34664897 CAGGAGGCCTGACACTGATGAGG + Exonic
1053539188 9:38955982-38956004 TCAGAGGCCTGACACTCAGGAGG + Intergenic
1053884041 9:42626306-42626328 TTTGAGGCCTGTTACTTAGGGGG + Intergenic
1053888627 9:42667988-42668010 TTTGAGGCCTGTTACTTAGGGGG - Intergenic
1054223061 9:62433752-62433774 TTTGAGGCCTGTTACTTAGGGGG + Intergenic
1054227649 9:62475435-62475457 TTTGAGGCCTGTTACTTAGGGGG - Intergenic
1054626953 9:67407937-67407959 TCAGAGGCCTGACACTCAGGAGG - Intergenic
1055854510 9:80669832-80669854 TTATACGCCTGCCACTGGGGAGG + Intergenic
1057016919 9:91659944-91659966 AGGGAGGGATGCCACTGAGGTGG + Intronic
1059265416 9:113024306-113024328 TTGGTGGCCTGCCCCTCATGGGG + Intergenic
1060944577 9:127562330-127562352 ATCCAGGCCTGCCACTGAGGTGG + Intronic
1061391460 9:130319432-130319454 TTGGGGACCTGCCGCTGAGCAGG + Intronic
1061659792 9:132121734-132121756 TTGGATGCCTGGCACTGTAGTGG + Intergenic
1062136200 9:134929720-134929742 TGGGAGGCCTCCCACTCAGGGGG - Intergenic
1062463584 9:136671800-136671822 TTGGAGCCCTGCCGCGGAGGCGG + Intronic
1062638075 9:137501848-137501870 TTGGAGGACAGCCTCGGAGGAGG - Intronic
1186826600 X:13346581-13346603 TTGAAGGCCTCCCACTGATCTGG - Intergenic
1187958567 X:24545191-24545213 GTGGAGCTGTGCCACTGAGGGGG + Intergenic
1190258860 X:48785830-48785852 TTGGAGGCGGGAAACTGAGGTGG - Intergenic
1192759937 X:74086368-74086390 TTGTGGGCCTTCCACTGGGGAGG - Intergenic
1195690093 X:107617195-107617217 TGGGAGCCCTTCCACTGAGAAGG + Intergenic
1196754329 X:119144589-119144611 TTGGAGCTCTGCCTCTGAAGTGG + Intronic
1197000646 X:121435135-121435157 TTGGAGTCCTCCCACTTAAGGGG + Intergenic
1198936728 X:141907199-141907221 ATGGAGTCCTCCCCCTGAGGAGG - Exonic
1199709485 X:150459056-150459078 TTGGTGTCCTGGCAATGAGGAGG + Intronic
1200176637 X:154121663-154121685 CAGGAGGACTGTCACTGAGGGGG + Intergenic
1202169115 Y:22022091-22022113 TTGGTGTTCTGCCTCTGAGGTGG + Intergenic
1202222246 Y:22564277-22564299 TTGGTGTTCTGCCTCTGAGGTGG - Intergenic
1202320869 Y:23631384-23631406 TTGGTGTTCTGCCTCTGAGGTGG + Intergenic
1202549898 Y:26038672-26038694 TTGGTGTTCTGCCTCTGAGGTGG - Intergenic