ID: 1079539415

View in Genome Browser
Species Human (GRCh38)
Location 11:21554007-21554029
Sequence ATGTAAAAACATATAAATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 338}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079539413_1079539415 -3 Left 1079539413 11:21553987-21554009 CCTCCTACTCATAAGCAGATATG 0: 1
1: 0
2: 0
3: 5
4: 128
Right 1079539415 11:21554007-21554029 ATGTAAAAACATATAAATCGTGG 0: 1
1: 0
2: 1
3: 28
4: 338
1079539414_1079539415 -6 Left 1079539414 11:21553990-21554012 CCTACTCATAAGCAGATATGTAA 0: 1
1: 0
2: 0
3: 13
4: 176
Right 1079539415 11:21554007-21554029 ATGTAAAAACATATAAATCGTGG 0: 1
1: 0
2: 1
3: 28
4: 338
1079539411_1079539415 1 Left 1079539411 11:21553983-21554005 CCACCCTCCTACTCATAAGCAGA 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1079539415 11:21554007-21554029 ATGTAAAAACATATAAATCGTGG 0: 1
1: 0
2: 1
3: 28
4: 338
1079539412_1079539415 -2 Left 1079539412 11:21553986-21554008 CCCTCCTACTCATAAGCAGATAT 0: 1
1: 0
2: 1
3: 12
4: 137
Right 1079539415 11:21554007-21554029 ATGTAAAAACATATAAATCGTGG 0: 1
1: 0
2: 1
3: 28
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079539415 Original CRISPR ATGTAAAAACATATAAATCG TGG Intronic
906582082 1:46944208-46944230 ATGTAAAACCATAAAAAGCCTGG + Intergenic
906601634 1:47134692-47134714 ATGTAAAACCATAAAAAGCCTGG - Intergenic
907002432 1:50875050-50875072 ATGTAAAAATATAAAAAACATGG - Intronic
907023526 1:51092792-51092814 ATATAAAAATATGTAAATTGAGG + Intergenic
907493244 1:54824180-54824202 AAGTAAAAAAATATATATCTAGG - Intronic
908301550 1:62765798-62765820 ATTTAAAAACATGTAAAACAAGG - Intergenic
908411836 1:63874060-63874082 ATGTAAAAACATTTAAAAATGGG + Intronic
908562049 1:65316250-65316272 ATGCAAAAACATAAAGATGGAGG - Intronic
908971217 1:69834060-69834082 ATGTAAAAAGATTTAACTCAAGG - Intronic
910072965 1:83242109-83242131 AGGTAAAAATATATAAATGTTGG - Intergenic
912766073 1:112412469-112412491 ATGTTAATACTTATAAATGGTGG + Intronic
915816880 1:158977095-158977117 ATGTAAAAGCAAATAAACTGTGG + Intergenic
916500175 1:165380378-165380400 AGGTAAAAAGAAATAAATCGGGG - Intergenic
917007951 1:170436437-170436459 ATGCAAAAATATATAAAACATGG - Intergenic
918682284 1:187370601-187370623 CTGTAAAAATATATATATAGTGG + Intergenic
918970446 1:191409090-191409112 AAGTCAAAACATAAAAAACGAGG + Intergenic
919362782 1:196615739-196615761 ATTTAAAAACAGATAAATGAAGG - Intergenic
919366000 1:196661672-196661694 AGGTTTAAACATATAAATTGGGG + Intronic
919514025 1:198499337-198499359 ATATAAAACCAAATAAATGGTGG + Intergenic
921106698 1:211988120-211988142 ATGTTAAAAAACTTAAATCGAGG + Intronic
922687589 1:227656557-227656579 ATGAAAAAGCATATAAATGATGG - Exonic
1064317088 10:14268502-14268524 ATGAAAAAATAAATAAATCGAGG - Intronic
1068022972 10:51607379-51607401 ATGTAGCTACATATAAAACGAGG + Intronic
1068742605 10:60491274-60491296 ATGAAGAAACATATAAAGTGAGG + Intronic
1068993564 10:63177380-63177402 ATGTAAAAACAAATATTTCATGG - Intronic
1069330805 10:67290467-67290489 ATGCAAAACCATAAAAATCATGG + Intronic
1070455172 10:76607201-76607223 ATGTAATAACATAAAAATGAGGG + Intergenic
1071103635 10:82068574-82068596 CTGTAAGAACACATAAATAGGGG + Intronic
1071858797 10:89651636-89651658 ATGTAAAGAAATATAATTTGAGG + Intergenic
1073182338 10:101591985-101592007 ATGTATAAAAATATAAATTATGG - Intronic
1073681696 10:105711886-105711908 ATGAGAAGACACATAAATCGTGG - Intergenic
1073806095 10:107100136-107100158 AGGTAAAAACATTTAAATGCTGG - Intronic
1073838633 10:107472674-107472696 ATGTAAATACAGATAATTCAAGG - Intergenic
1073872196 10:107878301-107878323 ATGTATATACATATAACTCAAGG - Intergenic
1074606702 10:114978584-114978606 ATGCCAAAACATTTAAATAGAGG + Intergenic
1075224611 10:120616147-120616169 GTGTATAAACATATATATTGTGG + Intergenic
1077553028 11:3210731-3210753 ATGTAAAAAGATATAAAATGAGG - Intergenic
1079539415 11:21554007-21554029 ATGTAAAAACATATAAATCGTGG + Intronic
1079906587 11:26255725-26255747 ATGTATAAACAAATAAATAATGG - Intergenic
1080343110 11:31292058-31292080 ATATAAAAACACATATACCGTGG + Intronic
1080819238 11:35789443-35789465 ATGTAAAAACATATAGCACATGG - Intronic
1081093242 11:38899355-38899377 ATGTAAAAACATTTTAAGCTTGG - Intergenic
1081093250 11:38899502-38899524 ATGTAGAAACATATTAAGCTTGG - Intergenic
1081134556 11:39423203-39423225 TTGTAAAAACATATATTTCTAGG - Intergenic
1082258129 11:50054970-50054992 ATGTAAAAATGTATAAAACAAGG - Intergenic
1083361028 11:62108294-62108316 ATGTTAAAACATAAAAATGAAGG - Intergenic
1085876834 11:80417710-80417732 ATGAAAAAACAAATGAATCCTGG + Intergenic
1086000410 11:81977255-81977277 ATTTAATAACACATAAATTGAGG + Intergenic
1086143695 11:83526962-83526984 GTGTAAAGACAAATAAATCATGG - Intronic
1092606107 12:10121073-10121095 ATATAATAGCATATAAATTGAGG + Intronic
1093317387 12:17667747-17667769 ATGTTAAAACAGATATATCTGGG + Intergenic
1094101032 12:26762783-26762805 ATATAAATATATATAAATTGTGG + Intronic
1095154602 12:38837065-38837087 ATGTAAAATAATATAAATCATGG + Intronic
1097235168 12:57534458-57534480 ATGAAAAAAGGTAGAAATCGGGG + Intronic
1099072104 12:78058142-78058164 ATATAAAAACATAGAATTCTAGG + Intronic
1099072152 12:78058549-78058571 ATATAAAAACATAGAATTCTAGG + Intronic
1099139912 12:78960035-78960057 ATTTAAAAATATATAAATTTTGG - Intronic
1099194630 12:79601086-79601108 GTGCAAAAACCTATAAATTGTGG + Intronic
1099552931 12:84071168-84071190 ATGAAAAAGCAGACAAATCGTGG - Intergenic
1099867244 12:88298683-88298705 AGGTAACAACATTCAAATCGAGG - Intergenic
1100090543 12:90963776-90963798 AATTAAAAACATCTAAATCTTGG + Exonic
1100142934 12:91641165-91641187 ATGCAAAATAATATAAGTCGTGG - Intergenic
1100797086 12:98193725-98193747 ATATAAAAACCAATAAATGGAGG + Intergenic
1101928726 12:108994834-108994856 CTGTAAAAACATTTAAAAAGTGG - Intronic
1102132159 12:110540505-110540527 ATGTAAAAACAAATTAGGCGTGG - Intronic
1102778774 12:115544802-115544824 ATGTAAAATCATATAAAGGAGGG + Intergenic
1107219608 13:37966751-37966773 TTGTATAAACATGTAAATGGGGG - Intergenic
1107841717 13:44465109-44465131 ATTTAGGAACATATATATCGTGG + Intronic
1108594348 13:51937111-51937133 ATTTAAAGACATATAAAGCAGGG + Intronic
1108985511 13:56581622-56581644 ATTTAAAAACATTTTAATAGTGG + Intergenic
1109217938 13:59611340-59611362 ATTTAAAAATTTTTAAATCGTGG + Intergenic
1109482266 13:62972233-62972255 ATTTAAAATCATACAAATCATGG + Intergenic
1109485830 13:63017909-63017931 ATATAAATACATATAAATATAGG + Intergenic
1109675433 13:65669902-65669924 ATATAAAAATATGTAAATTGTGG - Intergenic
1110364366 13:74664603-74664625 ATGTAAAAACTAGCAAATCGTGG - Intergenic
1110643179 13:77850101-77850123 AAGGAAAGACATATAAATCAAGG - Intergenic
1110646826 13:77895728-77895750 ATGTAAAAAATTATATATCTGGG - Exonic
1111268266 13:85848541-85848563 ATGTAATAATATATATATTGGGG + Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1112951454 13:105002117-105002139 ATGTACATACATATAAATGTAGG - Intergenic
1112966436 13:105202228-105202250 AATTAAAAAAATATAAATGGGGG - Intergenic
1114273938 14:21124645-21124667 ATATAAAAAGATGTAAATTGTGG + Intergenic
1114942957 14:27638857-27638879 ATTTAAAAACAGATAAAATGAGG - Intergenic
1115169164 14:30484165-30484187 ATTTAAAAAAATAGAAATCTGGG - Intergenic
1115205842 14:30903157-30903179 ATATCAAAACAAATAAATGGGGG + Intronic
1116228532 14:42184831-42184853 TTGTAAAGTCATATAAATCAGGG - Intergenic
1116306210 14:43259963-43259985 AGGTAGAAAAATATAAATAGAGG + Intergenic
1117304025 14:54455978-54456000 ATGTAGAGACATAAAAATAGGGG - Intergenic
1118286802 14:64482046-64482068 AAGGAAATACATATTAATCGTGG - Exonic
1118548073 14:66917075-66917097 CTGTACAAACATATCAATAGTGG - Intronic
1120155644 14:81090091-81090113 ATGTTAAAACAACTAAATCTGGG + Intronic
1120468550 14:84893320-84893342 ATTTAAAAACATTTAAATACAGG - Intergenic
1123444967 15:20322961-20322983 ATTTTAAAATATATAAATAGGGG + Intergenic
1123915679 15:25023663-25023685 ATGTATAAACATATAAAGGGAGG - Intergenic
1124228857 15:27923172-27923194 ATGTATAAACATATACACCATGG - Intronic
1126561255 15:50046751-50046773 AAGGAAAAACATATGAATCAAGG - Intronic
1127589108 15:60405423-60405445 ATTTAAAAATCTATAAATAGAGG + Intergenic
1128779204 15:70347252-70347274 ATGTAAAAAAATGTAAATACTGG + Intergenic
1130660081 15:85824492-85824514 ATTAAAAAATATATATATCGTGG + Intergenic
1132051105 15:98608539-98608561 ATGCAAAAAAATAAAAATTGAGG + Intergenic
1133454087 16:5927886-5927908 ATCTAAAAACATCAAAATCCTGG + Intergenic
1135462140 16:22653879-22653901 ATGTAAAAAATTATAAATAATGG - Intergenic
1135598469 16:23761421-23761443 ATTTAAAAATATATATATCTGGG - Intergenic
1137251618 16:46745396-46745418 AAGTAAAAAATTAGAAATCGGGG + Intronic
1137364660 16:47850227-47850249 ATATAAAAACATAGAATTTGGGG + Intergenic
1138906709 16:61344623-61344645 ATAGAAACACATATAAATCTAGG + Intergenic
1139258509 16:65567630-65567652 ATGTAAAAACATATATATACAGG + Intergenic
1144017416 17:11209145-11209167 CTGTAAAAACACATCAATCGGGG - Intergenic
1146031231 17:29367643-29367665 ATGTAAAAAAATACTAATCTAGG - Intergenic
1146828178 17:36042363-36042385 ATGTAATAACCTATAAATGTCGG + Intergenic
1149364223 17:55924642-55924664 GTGTTAAAACATATAGATTGAGG - Intergenic
1152939679 17:83161614-83161636 ATCTCAAAACATGTAAATCTGGG - Intergenic
1154228432 18:12530365-12530387 CTCTAAAAACATAAAAATCGGGG - Intronic
1156143320 18:34143040-34143062 ATGTAAAAATTAATAAAACGAGG + Intronic
1156735095 18:40246487-40246509 AAATAAAGCCATATAAATCGGGG - Intergenic
1158384661 18:56975604-56975626 ATGGAAAAACATAAAAAAAGAGG - Intronic
1159148486 18:64486825-64486847 ATGAAAGAAGATATAAATCAAGG - Intergenic
1159344738 18:67186687-67186709 ATGATAAAACATAGAGATCGTGG - Intergenic
1160239169 18:77110807-77110829 ATTATAAAACATATAAATTGTGG + Intronic
1161364534 19:3870581-3870603 ATGAATAAACAAATAAATGGAGG + Intergenic
1166211183 19:41307554-41307576 ATGTTAAAACATATGAGTCAAGG - Intronic
1167148810 19:47697298-47697320 TTTTAAAAACATATAAGTCCGGG + Intronic
1168212887 19:54904341-54904363 ATCTAAAAAGATAAAAATAGGGG - Intergenic
925775926 2:7335804-7335826 ATGAAAAAAGAAAGAAATCGGGG + Intergenic
926102040 2:10123918-10123940 ATGGAAAAACATACAAGACGAGG - Intronic
926477423 2:13342169-13342191 ATTAATAAACATATAAATCCTGG + Intergenic
926542457 2:14198165-14198187 ATGTAAAAATATATAAAGTCAGG - Intergenic
928195601 2:29214515-29214537 ATTTTAAGACATTTAAATCGAGG - Intronic
928204408 2:29273760-29273782 ATGTATAAATTTATAAATGGAGG - Intronic
928622736 2:33107696-33107718 AATTAAAAAGATATAAATCCAGG - Intronic
928630598 2:33188073-33188095 TTTTAAAAACATATAAATTCAGG + Intronic
928679436 2:33684812-33684834 ATCTAACATCATATAAATGGGGG - Intergenic
928776008 2:34764660-34764682 ATGTAAAACCATAAAAACCCTGG - Intergenic
929675458 2:43922782-43922804 ATGTAACAATATTTAAATAGTGG + Intronic
931075503 2:58707013-58707035 AAGTAAAAAAAGATAATTCGAGG - Intergenic
932210638 2:69926623-69926645 ATCTAAAAATATATAAATCCAGG - Intronic
939648245 2:144728931-144728953 ATGGAAAAAAACATAAATTGTGG - Intergenic
939666288 2:144956093-144956115 ATTTAAAAAAGTATAAATCAAGG - Intergenic
940331462 2:152479581-152479603 ATGTAAAAACATCAAAGTCGAGG - Intronic
940435093 2:153642564-153642586 TTTTAAAAACATATAAAACAGGG + Intergenic
940606385 2:155928263-155928285 ATGTAAAAAATTATAAAAAGTGG - Intergenic
941128711 2:161619509-161619531 ATGTAAACACATGTGAATTGTGG + Intronic
941232067 2:162923257-162923279 ATTTAATAACAGATAAATCTTGG + Intergenic
941301222 2:163804335-163804357 ATTTAAAAACATTTAATTCTGGG + Intergenic
941728408 2:168889201-168889223 ATGTGAAAAAGTATAAATCATGG - Intronic
942059440 2:172214702-172214724 ATGTAAAAATATATATTTTGGGG + Intergenic
942938908 2:181593262-181593284 AAGTAAAAAGAGATAAATAGAGG + Intronic
943037505 2:182765381-182765403 ATGTAATAACATTAAAAACGGGG + Intronic
943432488 2:187822079-187822101 ATGTATACAAATATAAATAGTGG - Intergenic
943804519 2:192106799-192106821 ATGTAAAAATACATCAATAGTGG + Intronic
943910820 2:193564652-193564674 AAGTCACAACATATAAACCGAGG - Intergenic
944270302 2:197776398-197776420 ATGGAAAACCATATAAAACAAGG + Intronic
944299402 2:198105904-198105926 ATGTAAGAAAATATAAAAAGTGG - Intronic
944497500 2:200323490-200323512 ATGTAGAAATATATAACTCCTGG + Intronic
944704475 2:202275257-202275279 ATGTAACATTATATAAATCAGGG - Intronic
944862944 2:203832261-203832283 ATGTAGAAACATATGAAAGGTGG + Intergenic
944974778 2:205037241-205037263 ATATAAAAATATATATATAGTGG + Intronic
945918707 2:215732237-215732259 ATGTAAAAAAACATAAAAGGTGG + Intergenic
947058022 2:226129655-226129677 ATGTAAAAACAATTCTATCGTGG - Intergenic
947199906 2:227605762-227605784 AAGTAAAAACAGACAAATCCTGG + Intergenic
947418249 2:229920717-229920739 ATAAAAACACATGTAAATCGGGG - Intronic
1169030026 20:2399784-2399806 ATGTAAATACATTTAGATAGAGG - Intronic
1169338573 20:4777877-4777899 ATGCAAGAACAATTAAATCGGGG + Intergenic
1169659135 20:7958674-7958696 ATATAAAAAGATATAAAGTGAGG - Intergenic
1170244833 20:14209092-14209114 ATGTGGAAACAAATAAATTGAGG + Intronic
1170327063 20:15168309-15168331 ATTTTAATACATATAAATCGAGG + Intronic
1170804128 20:19615168-19615190 ATTTAAAAATATATATATCATGG + Intronic
1171749086 20:29029998-29030020 GTATACAAACATATAAATCAAGG + Intergenic
1173749532 20:45466440-45466462 GTGTAAAAAAATATATATCAGGG - Intergenic
1173770893 20:45656464-45656486 ATGTAAAACCATAAAAACCCTGG + Intronic
1174460523 20:50679230-50679252 ATTTAAAAATATATAAAATGAGG + Intronic
1175190510 20:57209232-57209254 ATATAAAAATATATAAATCTAGG - Intronic
1176669448 21:9718748-9718770 GTATAAAAACATATAAACCATGG - Intergenic
1177032378 21:15997327-15997349 ATGTAAAAACATCTACAACCTGG - Intergenic
1177286876 21:19062985-19063007 ATGTAAACATATATTAAACGTGG + Intergenic
1177955739 21:27596405-27596427 TTGTAAAAATATAGAAATTGTGG + Intergenic
1179004657 21:37501466-37501488 CTGTTAAAACATATAAAAAGTGG - Intronic
1179090190 21:38257746-38257768 ATTAAAAAACATATTAATCATGG - Intronic
1180393898 22:12311632-12311654 GTATACAAACATATAAATCAAGG - Intergenic
1180405848 22:12553118-12553140 GTATACAAACATATAAATCAAGG + Intergenic
1180849787 22:19010852-19010874 ATTTAAAAACATAAAAAACTGGG - Intergenic
1182387810 22:29961185-29961207 AGGTAAAAGCATATAAATTTGGG - Intronic
1182942804 22:34294057-34294079 ATGTAAAAATATAAAATTCCTGG - Intergenic
1183028593 22:35085075-35085097 ATGTAAAAACCTTTAACTCTAGG - Intronic
1183855965 22:40635448-40635470 ATGTAAAAACATACGAAGCATGG + Intronic
951201476 3:19879829-19879851 GTTTTAAAACATATAAATCATGG - Intronic
951250210 3:20385826-20385848 ATGTAGTAACTTATAAATTGTGG + Intergenic
951366520 3:21789709-21789731 ATGTAAAAAAAGATAAATCAAGG + Intronic
951692136 3:25407604-25407626 ATGTGCAAATATATAAAACGAGG - Intronic
951715999 3:25646979-25647001 ATGGAAAAACTTATAAATGTAGG - Intronic
951790219 3:26473879-26473901 AAATAAAAGCATATAATTCGTGG + Intergenic
952649260 3:35705202-35705224 GTGTAACAACATATAAATATTGG + Intronic
952983899 3:38760555-38760577 ATGTATAAATAAATAAATCATGG - Intronic
953006810 3:38986547-38986569 ATGTAAAAAGAAATCAATCCAGG + Intergenic
955107694 3:55914706-55914728 ATGTAAACACATGTAAACCTAGG + Intronic
956418178 3:69055322-69055344 ATATAAAAAAAGACAAATCGTGG + Exonic
956499859 3:69870681-69870703 ATTTAAAAATATATATATCCAGG - Intronic
957229706 3:77496382-77496404 ATGCTAATACATACAAATCGAGG - Intronic
957661811 3:83165893-83165915 ATGTACAAACATATGAATAATGG - Intergenic
957858116 3:85905411-85905433 ATGTCAATATATATAATTCGGGG - Intronic
958001484 3:87755481-87755503 ATGTAAAAAACTATAAAACCAGG + Intergenic
958613362 3:96456954-96456976 ATATAAAAATATTAAAATCGAGG + Intergenic
958825735 3:99028300-99028322 ATATAAAAATATGTAAATGGGGG + Intergenic
959805281 3:110544819-110544841 ACCTAAAAGCATATAAATCAGGG - Intergenic
960733735 3:120754941-120754963 ATGTAATAACGAATAAATCTAGG + Intronic
963607824 3:147426949-147426971 TTGTAAAAACATTTAAATAAGGG + Intronic
964022846 3:152035020-152035042 ATGTGAAAAAAAATAAATCTTGG - Intergenic
964087827 3:152838137-152838159 AAGAAAAAACATATATATGGAGG + Intergenic
964260746 3:154834030-154834052 ATGTAAAAACTTAAAAATCTGGG - Intergenic
964296103 3:155235167-155235189 ATGTAAAACTATAAAAATCCTGG - Intergenic
964315605 3:155440925-155440947 ATGTAAAAATTTATAAACCTGGG + Intronic
964514232 3:157490052-157490074 ATTTAAAAACATATAAATAAAGG + Intronic
964924071 3:161934597-161934619 ATGTATAAACTTCTAAATCAGGG - Intergenic
965128945 3:164669740-164669762 ATCTAAAACCATAAAAATCCTGG + Intergenic
965396012 3:168161101-168161123 ATGAAAAAAAATAAAAATCCAGG - Intergenic
966408914 3:179628645-179628667 ATATCAAAGCATATAAATCTAGG - Intergenic
967027018 3:185573634-185573656 ATGTAATAACATTAAAAACGGGG - Intergenic
968214007 3:196872579-196872601 ATGTAAAAACAAAGAATTCCTGG - Intronic
968719372 4:2188832-2188854 ATATAAAAACACATAAATCGAGG + Intronic
969536697 4:7760675-7760697 TTATAAAAATATATAAATGGAGG + Exonic
971478861 4:27096607-27096629 ATGTAAAAACATTTCACTAGGGG + Intergenic
971667678 4:29511766-29511788 ATATAAATATATATAAATAGAGG - Intergenic
972374113 4:38454698-38454720 ATGAAAAAGCAAATAAATCGGGG + Intergenic
972592988 4:40505585-40505607 ATTTAAAAACATATATATTTTGG + Intronic
972819837 4:42688016-42688038 ATGAATAAATATATAAATCATGG + Intergenic
974400489 4:61398810-61398832 ATGTAAGAACATGTAAATAAAGG + Intronic
974595538 4:64010990-64011012 ATATAAAAACAAATAATTCAAGG - Intergenic
974659401 4:64866073-64866095 ATGTAATAAAATAAAAATCAAGG + Intergenic
975049392 4:69841106-69841128 ATGAAATAATATATAAATAGGGG - Intronic
976216971 4:82724605-82724627 ATATAAAAAGATATACATGGTGG + Intronic
976825832 4:89259498-89259520 ATGCAAAAACATGCAAATGGAGG - Intronic
977018480 4:91727012-91727034 ATGAATAAACAGAAAAATCGAGG - Intergenic
977393435 4:96443112-96443134 ATGTAATAACACTTACATCGTGG - Intergenic
978100137 4:104828829-104828851 ATGTAAAAACATAGAGAACTAGG - Intergenic
978865473 4:113504059-113504081 ATTTAAAAACATTTAAAAGGAGG - Intronic
979761543 4:124411536-124411558 GTGAACAAACATATAAATTGGGG - Intergenic
980242646 4:130197338-130197360 ATGTAAAACCATAAAACTCTTGG + Intergenic
980946714 4:139328033-139328055 ATGTAGAAAAATATAATTAGTGG - Intronic
981132768 4:141176316-141176338 ATGTTTCAACATATAAATCATGG + Intronic
982805432 4:159756611-159756633 ATCCAAAAACAAATAAAACGTGG - Intergenic
983007639 4:162504209-162504231 ATGGTAAAACATATAAGTAGAGG + Intergenic
983366391 4:166795883-166795905 ATGTTATAACATATGAATCTGGG - Intronic
983670894 4:170236745-170236767 ATGTATAAACATACCAATCCCGG + Intergenic
984556791 4:181223969-181223991 ATTTAAAAACACATAAATTCTGG - Intergenic
985372796 4:189303980-189304002 ATTTCAAAACATAAAAATTGTGG + Intergenic
985405324 4:189632722-189632744 GTATAAAAACATATAAACCATGG + Intergenic
985430951 4:189879597-189879619 GTATACAAACATATAAATCAAGG + Intergenic
986898380 5:12399918-12399940 ATGTAAAAAAATGGAAATCTTGG - Intergenic
986965174 5:13261450-13261472 AATTAAAAATATATAAATAGTGG - Intergenic
987538983 5:19228840-19228862 ATGTAAAAACATATATTTGAAGG - Intergenic
987672590 5:21031149-21031171 ATCTAAAAACAAGTAAATCCGGG + Intergenic
987834050 5:23138171-23138193 CTGTATCAACATATAAATCTTGG + Intergenic
989323954 5:40168011-40168033 ATATATATATATATAAATCGGGG - Intergenic
990547040 5:56833168-56833190 ATATAAAAACAAAAAAATCATGG - Intronic
991495663 5:67223415-67223437 AAGTAAAACCACAGAAATCGGGG - Intergenic
992842353 5:80708696-80708718 ATATAAGAACATAAAAATCTAGG - Intronic
994089394 5:95796295-95796317 AGCTAAAAACATATAAATTCAGG - Exonic
994161553 5:96562085-96562107 ATGTAAAAACATATATGGCCGGG - Intronic
994532991 5:100990295-100990317 ATGTAAAAAAAAAAAAATGGGGG - Intergenic
994548018 5:101193141-101193163 ATTTAAAGACATATGAATTGAGG + Intergenic
995336905 5:111009878-111009900 ATTTAAAAAGAGATAAATCTTGG - Intergenic
995745743 5:115401207-115401229 ATGTAAAACTATAAAAATCCTGG - Intergenic
996159283 5:120143124-120143146 ATGAATAAACAAATAAATTGTGG + Intergenic
997038000 5:130215916-130215938 ATGCAAAAACATTTAAAAGGAGG + Intergenic
997548917 5:134735476-134735498 ATTTAAAAAAATTTAAAACGAGG - Intergenic
997764725 5:136489731-136489753 ATGTAACAACATATACATGGTGG - Intergenic
999533659 5:152491596-152491618 TTTTTAAAAGATATAAATCGAGG - Intergenic
1000130636 5:158294457-158294479 ATATAAATACATATAGATTGGGG - Intergenic
1002855783 6:1037066-1037088 AAGTAAAAACGTATATATAGGGG + Intergenic
1004976271 6:20970333-20970355 ATTAAAAAACAAATAAATCTTGG - Intronic
1006199505 6:32275211-32275233 AAGTAAAAACAAATAAAATGTGG + Intergenic
1008145796 6:47890192-47890214 ATATAAAAACATACAAATTTAGG - Intronic
1008699555 6:54082156-54082178 ATGTTAATACATATAATTCTAGG + Intronic
1009318241 6:62251351-62251373 ATGTAAAAATATGTAAATTTGGG + Intronic
1009868014 6:69421257-69421279 ATATAAACACATATATATCCTGG + Intergenic
1010184833 6:73132005-73132027 ATGTAAACACACATAAAACGTGG + Intronic
1010929746 6:81786947-81786969 ATGTAAAAACATAAAATTTTAGG - Intergenic
1012783541 6:103593273-103593295 ATATATAAAGATATAAATTGAGG - Intergenic
1012882821 6:104812190-104812212 ATGTAAAAACATAAAACATGAGG + Intronic
1013184121 6:107742996-107743018 ATATCAAAACATATAAATAGAGG + Intronic
1014351717 6:120354226-120354248 CTGTAACAACATATAACACGGGG - Intergenic
1014929174 6:127313050-127313072 ATATGAAAACATATAGATAGGGG + Intronic
1016729344 6:147411115-147411137 ATATAAAAACATTTAAAATGTGG - Intergenic
1017187542 6:151617162-151617184 ATGCAAAAGCAGATAAATCAGGG - Intronic
1017663277 6:156694626-156694648 ATGAATAAACAGATAAATGGTGG + Intergenic
1018138331 6:160800681-160800703 GTGAAAAAACATATAAAGCAAGG + Intergenic
1020600421 7:10268498-10268520 AGGTAAAAACATAAAAATGATGG + Intergenic
1020755577 7:12198340-12198362 ATGTAAGAAAATATTAATTGGGG + Intergenic
1020822357 7:12986085-12986107 ATGTAAAAAGGTAAAAATAGTGG + Intergenic
1020936369 7:14469739-14469761 AAATAAAAATATATGAATCGAGG + Intronic
1021290869 7:18843689-18843711 ATGTAAAATCATAGAAAAAGAGG - Intronic
1023692900 7:42810509-42810531 AAAAAAAAACATATAAATCAAGG + Intergenic
1024448430 7:49510156-49510178 ATGTACAAACATGTAATTTGTGG + Intergenic
1026351180 7:69516789-69516811 ATTTTAAAACATATAAACTGAGG + Intergenic
1026409095 7:70100707-70100729 ATTTAAAAACATTTAAATTTAGG + Intronic
1027290698 7:76707303-76707325 AGGTAAAAATATATAAATGTTGG - Intergenic
1027670034 7:81084965-81084987 ATTTAAAAACCTACAAATGGAGG - Intergenic
1028043169 7:86083940-86083962 CTGTAAAAACATATACTTCCTGG + Intergenic
1028339792 7:89704611-89704633 ATGTAAAAACACATAGATTGAGG - Intergenic
1028671728 7:93408278-93408300 TTTTAAAATCATCTAAATCGAGG - Intergenic
1031839282 7:126717697-126717719 TTGTAAAAACATAAAAATTTAGG + Intronic
1031841626 7:126748479-126748501 ATTTTAAAACATCTAAATAGTGG + Intronic
1032103541 7:129003911-129003933 ATGTGATTACATATAAATGGAGG - Intronic
1037070472 8:14640628-14640650 ATGTGCAAACATATATATAGGGG + Intronic
1037121430 8:15291983-15292005 ATGAAAAAATTTACAAATCGTGG + Intergenic
1037422673 8:18720496-18720518 CTGTAAACACATATAATTCCAGG - Intronic
1038028395 8:23613681-23613703 ATCTTAAGACATGTAAATCGGGG - Intergenic
1038050077 8:23800591-23800613 ATGTAAAAAGTTAAAAATCAAGG + Intergenic
1038156319 8:24994074-24994096 ATGTAAACATATAAAAATCCTGG - Intergenic
1040709006 8:50164922-50164944 ATTTAAAAACCTATAAATAAGGG - Intronic
1040760775 8:50840414-50840436 ATGAAAATACATAAAAGTCGAGG + Intergenic
1042762541 8:72286559-72286581 ATTTAAAAACATAGATATCTTGG + Intergenic
1043773293 8:84232274-84232296 ATGAAATAACATATACATGGTGG + Intronic
1043801309 8:84614007-84614029 CTGTAAAAGCTTATAAATTGTGG - Intronic
1044209400 8:89532968-89532990 ATGTAATCCCATGTAAATCGTGG + Intergenic
1044504320 8:93000642-93000664 ATATAAAAAGATATAAATTAAGG + Intronic
1044509860 8:93062105-93062127 ATATGCAAACATATAAATTGAGG + Intergenic
1045435214 8:102156573-102156595 ATGTAAAAAAATATATCTTGTGG - Intergenic
1046274759 8:111944107-111944129 ATGTAAAAAAATATAGTTTGAGG + Intergenic
1046542796 8:115608474-115608496 ATGTAAATACAAATAAATAAAGG - Intronic
1047040475 8:120989220-120989242 ATGGAAAAATAAATAAATCTTGG + Intergenic
1047774898 8:128061909-128061931 ATGAAAAAACATAGAAAGAGAGG + Intergenic
1047860033 8:128955765-128955787 ATTTAAAAACATAAAAATCATGG + Intergenic
1047871184 8:129083841-129083863 AGGTAAAGATATTTAAATCGAGG + Intergenic
1047965744 8:130045443-130045465 ATATAAATACATATAAATTGGGG - Intergenic
1051633685 9:19162889-19162911 TTGTAAAAAAAAATAAAACGGGG + Intergenic
1051972034 9:22900091-22900113 ATGGAAAAACATATAGAGCTGGG - Intergenic
1052139781 9:24966298-24966320 GTATACAAACATATAAATTGGGG + Intergenic
1053720178 9:40937800-40937822 GTATACAAACATATAAATCAAGG + Intergenic
1054917612 9:70510225-70510247 ATGTGCAAACATTTAAATAGTGG + Intergenic
1056029602 9:82539000-82539022 AAGTAATAACATTTAAATTGTGG + Intergenic
1057366868 9:94430818-94430840 ATGTAAAATCATATGAATGCTGG + Intronic
1057656468 9:96957247-96957269 ATGTAAAATCATATGAATGCTGG - Intronic
1058005358 9:99907727-99907749 ATGTAAAAAATTATTAATGGAGG - Intronic
1058395006 9:104541802-104541824 ATGAAAAAACATAAGAATCCTGG - Intergenic
1058830537 9:108812453-108812475 CTGTTAAAAGATATGAATCGGGG - Intergenic
1061103224 9:128508425-128508447 ATGAAAAAATATATACATCTAGG + Intronic
1203454951 Un_GL000219v1:158028-158050 GTATACAAACATATAAATCAAGG - Intergenic
1203656419 Un_KI270753v1:2188-2210 GTATAAAAACATATAAACCATGG + Intergenic
1186085541 X:5986234-5986256 AAGTATAAAAATATAAATTGCGG + Intronic
1186952974 X:14647826-14647848 ATGTAAAAACGTAGAAATTAAGG + Intronic
1187321657 X:18244446-18244468 ATGTAAAAAGATATGATTTGGGG + Intronic
1187572158 X:20515744-20515766 CTGTAAATACATATAATTCATGG - Intergenic
1187807033 X:23132022-23132044 TTCTAAAAACATATAAATAGCGG + Intergenic
1187929394 X:24280012-24280034 ATGTAAAAACTCAGAAATAGTGG + Intergenic
1188438935 X:30195247-30195269 AGGGAAAAACAAATAAGTCGTGG - Intergenic
1189189275 X:39083815-39083837 ATGGAACAACATATACATTGTGG + Intergenic
1189744425 X:44155420-44155442 ATGTCAAAGCAAATAAATCTAGG - Intronic
1190444736 X:50513189-50513211 TTGGAAAAATATATAAATTGAGG + Intergenic
1190487751 X:50945299-50945321 ATATATAAATATATAAATGGAGG - Intergenic
1190636851 X:52443242-52443264 ACCTAAAAACATAAAAATCCTGG - Intergenic
1192945477 X:75962302-75962324 ATGTAAAACCATAAAAACCCTGG - Intergenic
1192975275 X:76277108-76277130 ATATAAAAATATGTAAATTGAGG - Intergenic
1193173911 X:78369496-78369518 ATGTAAAATCATAAAAACCCTGG - Intergenic
1194368381 X:93037639-93037661 ATTTAAAAGCATATAAATCTGGG + Intergenic
1194682813 X:96874240-96874262 ATGTAAAAAGATATAAAGTCAGG - Intronic
1195061033 X:101194831-101194853 ATGTATATACATATAATTTGTGG - Intergenic
1195950809 X:110270697-110270719 ATGTAGAAACTTATAAATTGGGG - Intronic
1197015380 X:121619679-121619701 ATATAAAAACATGTAAATCATGG - Intergenic
1197354014 X:125412868-125412890 GTGTAAAAATATATAAATTGTGG - Intergenic
1198210712 X:134513091-134513113 ATATACATACATATACATCGGGG - Intronic
1198766926 X:140089891-140089913 ATGTTAAAAAATATATATTGTGG - Intergenic
1198810255 X:140528794-140528816 ATGTAAAAACATAGGAATTCTGG - Intergenic
1199340082 X:146667377-146667399 ATGTAAATAGATATAATTCAGGG + Intergenic
1199431793 X:147769941-147769963 TTATCAAAACATATAAATGGAGG - Intergenic
1200676585 Y:6153916-6153938 ATTTAAAAGCATATAAATCTGGG + Intergenic
1202348958 Y:23966369-23966391 ATATATAAATATATAAATAGAGG + Intergenic
1202521817 Y:25703735-25703757 ATATATAAATATATAAATAGAGG - Intergenic