ID: 1079543404

View in Genome Browser
Species Human (GRCh38)
Location 11:21603394-21603416
Sequence ATACAATGCTGGGAGAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079543397_1079543404 13 Left 1079543397 11:21603358-21603380 CCTTCAACATTTGTGTTCGCCTC No data
Right 1079543404 11:21603394-21603416 ATACAATGCTGGGAGAAAAGGGG No data
1079543398_1079543404 -6 Left 1079543398 11:21603377-21603399 CCTCTCCAGAACTTACTATACAA No data
Right 1079543404 11:21603394-21603416 ATACAATGCTGGGAGAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079543404 Original CRISPR ATACAATGCTGGGAGAAAAG GGG Intergenic
No off target data available for this crispr