ID: 1079543605

View in Genome Browser
Species Human (GRCh38)
Location 11:21606284-21606306
Sequence GACTCTTGTGCTCCTCAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079543605_1079543607 24 Left 1079543605 11:21606284-21606306 CCTAATTGAGGAGCACAAGAGTC No data
Right 1079543607 11:21606331-21606353 AAATTTATCATTATAAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079543605 Original CRISPR GACTCTTGTGCTCCTCAATT AGG (reversed) Intergenic
No off target data available for this crispr