ID: 1079547194

View in Genome Browser
Species Human (GRCh38)
Location 11:21646823-21646845
Sequence GTTGTAATGTGACAAAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079547194_1079547198 12 Left 1079547194 11:21646823-21646845 CCCACTTTTTGTCACATTACAAC No data
Right 1079547198 11:21646858-21646880 AGACAATGTAACTTCTTTGAGGG No data
1079547194_1079547197 11 Left 1079547194 11:21646823-21646845 CCCACTTTTTGTCACATTACAAC No data
Right 1079547197 11:21646857-21646879 AAGACAATGTAACTTCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079547194 Original CRISPR GTTGTAATGTGACAAAAAGT GGG (reversed) Intergenic
No off target data available for this crispr