ID: 1079547198

View in Genome Browser
Species Human (GRCh38)
Location 11:21646858-21646880
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079547194_1079547198 12 Left 1079547194 11:21646823-21646845 CCCACTTTTTGTCACATTACAAC No data
Right 1079547198 11:21646858-21646880 AGACAATGTAACTTCTTTGAGGG No data
1079547196_1079547198 -10 Left 1079547196 11:21646845-21646867 CCTATGTACGTAAAGACAATGTA No data
Right 1079547198 11:21646858-21646880 AGACAATGTAACTTCTTTGAGGG No data
1079547192_1079547198 21 Left 1079547192 11:21646814-21646836 CCATTACCACCCACTTTTTGTCA No data
Right 1079547198 11:21646858-21646880 AGACAATGTAACTTCTTTGAGGG No data
1079547195_1079547198 11 Left 1079547195 11:21646824-21646846 CCACTTTTTGTCACATTACAACC No data
Right 1079547198 11:21646858-21646880 AGACAATGTAACTTCTTTGAGGG No data
1079547193_1079547198 15 Left 1079547193 11:21646820-21646842 CCACCCACTTTTTGTCACATTAC No data
Right 1079547198 11:21646858-21646880 AGACAATGTAACTTCTTTGAGGG No data
1079547191_1079547198 29 Left 1079547191 11:21646806-21646828 CCATTTCTCCATTACCACCCACT No data
Right 1079547198 11:21646858-21646880 AGACAATGTAACTTCTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079547198 Original CRISPR AGACAATGTAACTTCTTTGA GGG Intergenic
No off target data available for this crispr