ID: 1079547359

View in Genome Browser
Species Human (GRCh38)
Location 11:21648512-21648534
Sequence TAGGGGTGCCGGCAGAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079547359_1079547368 4 Left 1079547359 11:21648512-21648534 CCCAGATTCTGCCGGCACCCCTA No data
Right 1079547368 11:21648539-21648561 TGGTACCTATTTCTGGGTATTGG No data
1079547359_1079547367 -2 Left 1079547359 11:21648512-21648534 CCCAGATTCTGCCGGCACCCCTA No data
Right 1079547367 11:21648533-21648555 TAGAATTGGTACCTATTTCTGGG No data
1079547359_1079547366 -3 Left 1079547359 11:21648512-21648534 CCCAGATTCTGCCGGCACCCCTA No data
Right 1079547366 11:21648532-21648554 CTAGAATTGGTACCTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079547359 Original CRISPR TAGGGGTGCCGGCAGAATCT GGG (reversed) Intergenic
No off target data available for this crispr