ID: 1079548128

View in Genome Browser
Species Human (GRCh38)
Location 11:21660204-21660226
Sequence TTGTCTATGAACTAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079548128_1079548130 3 Left 1079548128 11:21660204-21660226 CCTTCTTCCTAGTTCATAGACAA No data
Right 1079548130 11:21660230-21660252 TCTTTTTGTTGTGTCCTTAAAGG No data
1079548128_1079548132 7 Left 1079548128 11:21660204-21660226 CCTTCTTCCTAGTTCATAGACAA No data
Right 1079548132 11:21660234-21660256 TTTGTTGTGTCCTTAAAGGGTGG No data
1079548128_1079548137 30 Left 1079548128 11:21660204-21660226 CCTTCTTCCTAGTTCATAGACAA No data
Right 1079548137 11:21660257-21660279 AAGAGGCAGAGGTCTCTTCTGGG No data
1079548128_1079548136 29 Left 1079548128 11:21660204-21660226 CCTTCTTCCTAGTTCATAGACAA No data
Right 1079548136 11:21660256-21660278 GAAGAGGCAGAGGTCTCTTCTGG No data
1079548128_1079548131 4 Left 1079548128 11:21660204-21660226 CCTTCTTCCTAGTTCATAGACAA No data
Right 1079548131 11:21660231-21660253 CTTTTTGTTGTGTCCTTAAAGGG No data
1079548128_1079548135 19 Left 1079548128 11:21660204-21660226 CCTTCTTCCTAGTTCATAGACAA No data
Right 1079548135 11:21660246-21660268 TTAAAGGGTGGAAGAGGCAGAGG No data
1079548128_1079548133 13 Left 1079548128 11:21660204-21660226 CCTTCTTCCTAGTTCATAGACAA No data
Right 1079548133 11:21660240-21660262 GTGTCCTTAAAGGGTGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079548128 Original CRISPR TTGTCTATGAACTAGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr