ID: 1079556627

View in Genome Browser
Species Human (GRCh38)
Location 11:21766531-21766553
Sequence GTTTATCAACAGATTAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079556627_1079556629 23 Left 1079556627 11:21766531-21766553 CCTCTCTTAATCTGTTGATAAAC No data
Right 1079556629 11:21766577-21766599 GAGTTCCTTCATACATTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079556627 Original CRISPR GTTTATCAACAGATTAAGAG AGG (reversed) Intergenic
No off target data available for this crispr