ID: 1079559520

View in Genome Browser
Species Human (GRCh38)
Location 11:21804561-21804583
Sequence CAAAATCCTAACAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079559520_1079559523 4 Left 1079559520 11:21804561-21804583 CCCATATCACTGTTAGGATTTTG No data
Right 1079559523 11:21804588-21804610 ATGCCATTCAACAAGTCTCTAGG 0: 15
1: 1472
2: 1909
3: 1408
4: 919

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079559520 Original CRISPR CAAAATCCTAACAGTGATAT GGG (reversed) Intergenic
No off target data available for this crispr