ID: 1079559520

View in Genome Browser
Species Human (GRCh38)
Location 11:21804561-21804583
Sequence CAAAATCCTAACAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079559520_1079559523 4 Left 1079559520 11:21804561-21804583 CCCATATCACTGTTAGGATTTTG No data
Right 1079559523 11:21804588-21804610 ATGCCATTCAACAAGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079559520 Original CRISPR CAAAATCCTAACAGTGATAT GGG (reversed) Intergenic