ID: 1079560292

View in Genome Browser
Species Human (GRCh38)
Location 11:21812459-21812481
Sequence GCCGAGGCGGGCGGATCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215242
Summary {0: 11853, 1: 31231, 2: 59993, 3: 65789, 4: 46376}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079560292_1079560298 -7 Left 1079560292 11:21812459-21812481 CCTCGTGATCCGCCCGCCTCGGC 0: 11853
1: 31231
2: 59993
3: 65789
4: 46376
Right 1079560298 11:21812475-21812497 CCTCGGCCTCCCAAAGTGCTGGG 0: 120847
1: 270445
2: 211583
3: 123288
4: 170743
1079560292_1079560296 -8 Left 1079560292 11:21812459-21812481 CCTCGTGATCCGCCCGCCTCGGC 0: 11853
1: 31231
2: 59993
3: 65789
4: 46376
Right 1079560296 11:21812474-21812496 GCCTCGGCCTCCCAAAGTGCTGG 0: 81513
1: 207817
2: 222817
3: 151393
4: 177060
1079560292_1079560304 24 Left 1079560292 11:21812459-21812481 CCTCGTGATCCGCCCGCCTCGGC 0: 11853
1: 31231
2: 59993
3: 65789
4: 46376
Right 1079560304 11:21812506-21812528 CGTGAGTCACCGCGCCCGCCGGG No data
1079560292_1079560303 23 Left 1079560292 11:21812459-21812481 CCTCGTGATCCGCCCGCCTCGGC 0: 11853
1: 31231
2: 59993
3: 65789
4: 46376
Right 1079560303 11:21812505-21812527 GCGTGAGTCACCGCGCCCGCCGG No data
1079560292_1079560305 29 Left 1079560292 11:21812459-21812481 CCTCGTGATCCGCCCGCCTCGGC 0: 11853
1: 31231
2: 59993
3: 65789
4: 46376
Right 1079560305 11:21812511-21812533 GTCACCGCGCCCGCCGGGAATGG No data
1079560292_1079560300 1 Left 1079560292 11:21812459-21812481 CCTCGTGATCCGCCCGCCTCGGC 0: 11853
1: 31231
2: 59993
3: 65789
4: 46376
Right 1079560300 11:21812483-21812505 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079560292 Original CRISPR GCCGAGGCGGGCGGATCACG AGG (reversed) Intergenic
Too many off-targets to display for this crispr