ID: 1079560293

View in Genome Browser
Species Human (GRCh38)
Location 11:21812468-21812490
Sequence CTTTGGGAGGCCGAGGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079560293_1079560305 20 Left 1079560293 11:21812468-21812490 CCGCCCGCCTCGGCCTCCCAAAG No data
Right 1079560305 11:21812511-21812533 GTCACCGCGCCCGCCGGGAATGG No data
1079560293_1079560304 15 Left 1079560293 11:21812468-21812490 CCGCCCGCCTCGGCCTCCCAAAG No data
Right 1079560304 11:21812506-21812528 CGTGAGTCACCGCGCCCGCCGGG No data
1079560293_1079560303 14 Left 1079560293 11:21812468-21812490 CCGCCCGCCTCGGCCTCCCAAAG No data
Right 1079560303 11:21812505-21812527 GCGTGAGTCACCGCGCCCGCCGG No data
1079560293_1079560300 -8 Left 1079560293 11:21812468-21812490 CCGCCCGCCTCGGCCTCCCAAAG No data
Right 1079560300 11:21812483-21812505 TCCCAAAGTGCTGGGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079560293 Original CRISPR CTTTGGGAGGCCGAGGCGGG CGG (reversed) Intergenic