ID: 1079560294

View in Genome Browser
Species Human (GRCh38)
Location 11:21812471-21812493
Sequence GCACTTTGGGAGGCCGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 867824
Summary {0: 84291, 1: 218536, 2: 234154, 3: 158283, 4: 172560}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079560294_1079560304 12 Left 1079560294 11:21812471-21812493 CCCGCCTCGGCCTCCCAAAGTGC 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
Right 1079560304 11:21812506-21812528 CGTGAGTCACCGCGCCCGCCGGG No data
1079560294_1079560303 11 Left 1079560294 11:21812471-21812493 CCCGCCTCGGCCTCCCAAAGTGC 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
Right 1079560303 11:21812505-21812527 GCGTGAGTCACCGCGCCCGCCGG No data
1079560294_1079560305 17 Left 1079560294 11:21812471-21812493 CCCGCCTCGGCCTCCCAAAGTGC 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
Right 1079560305 11:21812511-21812533 GTCACCGCGCCCGCCGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079560294 Original CRISPR GCACTTTGGGAGGCCGAGGC GGG (reversed) Intergenic
Too many off-targets to display for this crispr