ID: 1079560295

View in Genome Browser
Species Human (GRCh38)
Location 11:21812472-21812494
Sequence AGCACTTTGGGAGGCCGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 536358
Summary {0: 87986, 1: 182858, 2: 138884, 3: 74939, 4: 51691}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079560295_1079560304 11 Left 1079560295 11:21812472-21812494 CCGCCTCGGCCTCCCAAAGTGCT 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
Right 1079560304 11:21812506-21812528 CGTGAGTCACCGCGCCCGCCGGG No data
1079560295_1079560303 10 Left 1079560295 11:21812472-21812494 CCGCCTCGGCCTCCCAAAGTGCT 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
Right 1079560303 11:21812505-21812527 GCGTGAGTCACCGCGCCCGCCGG No data
1079560295_1079560305 16 Left 1079560295 11:21812472-21812494 CCGCCTCGGCCTCCCAAAGTGCT 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
Right 1079560305 11:21812511-21812533 GTCACCGCGCCCGCCGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079560295 Original CRISPR AGCACTTTGGGAGGCCGAGG CGG (reversed) Intergenic
Too many off-targets to display for this crispr