ID: 1079560297 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:21812475-21812497 |
| Sequence | CCCAGCACTTTGGGAGGCCG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 888921 | |||
| Summary | {0: 114360, 1: 259489, 2: 214307, 3: 130302, 4: 170463} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1079560297_1079560304 | 8 | Left | 1079560297 | 11:21812475-21812497 | CCTCGGCCTCCCAAAGTGCTGGG | 0: 114360 1: 259489 2: 214307 3: 130302 4: 170463 |
||
| Right | 1079560304 | 11:21812506-21812528 | CGTGAGTCACCGCGCCCGCCGGG | No data | ||||
| 1079560297_1079560305 | 13 | Left | 1079560297 | 11:21812475-21812497 | CCTCGGCCTCCCAAAGTGCTGGG | 0: 114360 1: 259489 2: 214307 3: 130302 4: 170463 |
||
| Right | 1079560305 | 11:21812511-21812533 | GTCACCGCGCCCGCCGGGAATGG | No data | ||||
| 1079560297_1079560303 | 7 | Left | 1079560297 | 11:21812475-21812497 | CCTCGGCCTCCCAAAGTGCTGGG | 0: 114360 1: 259489 2: 214307 3: 130302 4: 170463 |
||
| Right | 1079560303 | 11:21812505-21812527 | GCGTGAGTCACCGCGCCCGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1079560297 | Original CRISPR | CCCAGCACTTTGGGAGGCCG AGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||