ID: 1079560297

View in Genome Browser
Species Human (GRCh38)
Location 11:21812475-21812497
Sequence CCCAGCACTTTGGGAGGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 888921
Summary {0: 114360, 1: 259489, 2: 214307, 3: 130302, 4: 170463}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079560297_1079560304 8 Left 1079560297 11:21812475-21812497 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 1079560304 11:21812506-21812528 CGTGAGTCACCGCGCCCGCCGGG No data
1079560297_1079560305 13 Left 1079560297 11:21812475-21812497 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 1079560305 11:21812511-21812533 GTCACCGCGCCCGCCGGGAATGG No data
1079560297_1079560303 7 Left 1079560297 11:21812475-21812497 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 1079560303 11:21812505-21812527 GCGTGAGTCACCGCGCCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079560297 Original CRISPR CCCAGCACTTTGGGAGGCCG AGG (reversed) Intergenic
Too many off-targets to display for this crispr