ID: 1079560299

View in Genome Browser
Species Human (GRCh38)
Location 11:21812481-21812503
Sequence TGTAATCCCAGCACTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079560299_1079560304 2 Left 1079560299 11:21812481-21812503 CCTCCCAAAGTGCTGGGATTACA No data
Right 1079560304 11:21812506-21812528 CGTGAGTCACCGCGCCCGCCGGG No data
1079560299_1079560303 1 Left 1079560299 11:21812481-21812503 CCTCCCAAAGTGCTGGGATTACA No data
Right 1079560303 11:21812505-21812527 GCGTGAGTCACCGCGCCCGCCGG No data
1079560299_1079560310 25 Left 1079560299 11:21812481-21812503 CCTCCCAAAGTGCTGGGATTACA No data
Right 1079560310 11:21812529-21812551 AATGGATATTTTGCACTACTTGG No data
1079560299_1079560305 7 Left 1079560299 11:21812481-21812503 CCTCCCAAAGTGCTGGGATTACA No data
Right 1079560305 11:21812511-21812533 GTCACCGCGCCCGCCGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079560299 Original CRISPR TGTAATCCCAGCACTTTGGG AGG (reversed) Intergenic