ID: 1079560300

View in Genome Browser
Species Human (GRCh38)
Location 11:21812483-21812505
Sequence TCCCAAAGTGCTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079560290_1079560300 6 Left 1079560290 11:21812454-21812476 CCTGACCTCGTGATCCGCCCGCC No data
Right 1079560300 11:21812483-21812505 TCCCAAAGTGCTGGGATTACAGG No data
1079560293_1079560300 -8 Left 1079560293 11:21812468-21812490 CCGCCCGCCTCGGCCTCCCAAAG No data
Right 1079560300 11:21812483-21812505 TCCCAAAGTGCTGGGATTACAGG No data
1079560292_1079560300 1 Left 1079560292 11:21812459-21812481 CCTCGTGATCCGCCCGCCTCGGC No data
Right 1079560300 11:21812483-21812505 TCCCAAAGTGCTGGGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079560300 Original CRISPR TCCCAAAGTGCTGGGATTAC AGG Intergenic