ID: 1079560301

View in Genome Browser
Species Human (GRCh38)
Location 11:21812484-21812506
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079560301_1079560303 -2 Left 1079560301 11:21812484-21812506 CCCAAAGTGCTGGGATTACAGGC No data
Right 1079560303 11:21812505-21812527 GCGTGAGTCACCGCGCCCGCCGG No data
1079560301_1079560305 4 Left 1079560301 11:21812484-21812506 CCCAAAGTGCTGGGATTACAGGC No data
Right 1079560305 11:21812511-21812533 GTCACCGCGCCCGCCGGGAATGG No data
1079560301_1079560310 22 Left 1079560301 11:21812484-21812506 CCCAAAGTGCTGGGATTACAGGC No data
Right 1079560310 11:21812529-21812551 AATGGATATTTTGCACTACTTGG No data
1079560301_1079560304 -1 Left 1079560301 11:21812484-21812506 CCCAAAGTGCTGGGATTACAGGC No data
Right 1079560304 11:21812506-21812528 CGTGAGTCACCGCGCCCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079560301 Original CRISPR GCCTGTAATCCCAGCACTTT GGG (reversed) Intergenic