ID: 1079560303

View in Genome Browser
Species Human (GRCh38)
Location 11:21812505-21812527
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079560292_1079560303 23 Left 1079560292 11:21812459-21812481 CCTCGTGATCCGCCCGCCTCGGC No data
Right 1079560303 11:21812505-21812527 GCGTGAGTCACCGCGCCCGCCGG No data
1079560293_1079560303 14 Left 1079560293 11:21812468-21812490 CCGCCCGCCTCGGCCTCCCAAAG No data
Right 1079560303 11:21812505-21812527 GCGTGAGTCACCGCGCCCGCCGG No data
1079560297_1079560303 7 Left 1079560297 11:21812475-21812497 CCTCGGCCTCCCAAAGTGCTGGG No data
Right 1079560303 11:21812505-21812527 GCGTGAGTCACCGCGCCCGCCGG No data
1079560302_1079560303 -3 Left 1079560302 11:21812485-21812507 CCAAAGTGCTGGGATTACAGGCG No data
Right 1079560303 11:21812505-21812527 GCGTGAGTCACCGCGCCCGCCGG No data
1079560299_1079560303 1 Left 1079560299 11:21812481-21812503 CCTCCCAAAGTGCTGGGATTACA No data
Right 1079560303 11:21812505-21812527 GCGTGAGTCACCGCGCCCGCCGG No data
1079560301_1079560303 -2 Left 1079560301 11:21812484-21812506 CCCAAAGTGCTGGGATTACAGGC No data
Right 1079560303 11:21812505-21812527 GCGTGAGTCACCGCGCCCGCCGG No data
1079560294_1079560303 11 Left 1079560294 11:21812471-21812493 CCCGCCTCGGCCTCCCAAAGTGC No data
Right 1079560303 11:21812505-21812527 GCGTGAGTCACCGCGCCCGCCGG No data
1079560295_1079560303 10 Left 1079560295 11:21812472-21812494 CCGCCTCGGCCTCCCAAAGTGCT No data
Right 1079560303 11:21812505-21812527 GCGTGAGTCACCGCGCCCGCCGG No data
1079560290_1079560303 28 Left 1079560290 11:21812454-21812476 CCTGACCTCGTGATCCGCCCGCC No data
Right 1079560303 11:21812505-21812527 GCGTGAGTCACCGCGCCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079560303 Original CRISPR GCGTGAGTCACCGCGCCCGC CGG Intergenic