ID: 1079560305

View in Genome Browser
Species Human (GRCh38)
Location 11:21812511-21812533
Sequence GTCACCGCGCCCGCCGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079560299_1079560305 7 Left 1079560299 11:21812481-21812503 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1079560305 11:21812511-21812533 GTCACCGCGCCCGCCGGGAATGG No data
1079560294_1079560305 17 Left 1079560294 11:21812471-21812493 CCCGCCTCGGCCTCCCAAAGTGC 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
Right 1079560305 11:21812511-21812533 GTCACCGCGCCCGCCGGGAATGG No data
1079560295_1079560305 16 Left 1079560295 11:21812472-21812494 CCGCCTCGGCCTCCCAAAGTGCT 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
Right 1079560305 11:21812511-21812533 GTCACCGCGCCCGCCGGGAATGG No data
1079560302_1079560305 3 Left 1079560302 11:21812485-21812507 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 1079560305 11:21812511-21812533 GTCACCGCGCCCGCCGGGAATGG No data
1079560293_1079560305 20 Left 1079560293 11:21812468-21812490 CCGCCCGCCTCGGCCTCCCAAAG 0: 39056
1: 119917
2: 190535
3: 147315
4: 99766
Right 1079560305 11:21812511-21812533 GTCACCGCGCCCGCCGGGAATGG No data
1079560292_1079560305 29 Left 1079560292 11:21812459-21812481 CCTCGTGATCCGCCCGCCTCGGC 0: 11853
1: 31231
2: 59993
3: 65789
4: 46376
Right 1079560305 11:21812511-21812533 GTCACCGCGCCCGCCGGGAATGG No data
1079560301_1079560305 4 Left 1079560301 11:21812484-21812506 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1079560305 11:21812511-21812533 GTCACCGCGCCCGCCGGGAATGG No data
1079560297_1079560305 13 Left 1079560297 11:21812475-21812497 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 1079560305 11:21812511-21812533 GTCACCGCGCCCGCCGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079560305 Original CRISPR GTCACCGCGCCCGCCGGGAA TGG Intergenic
No off target data available for this crispr