ID: 1079560310

View in Genome Browser
Species Human (GRCh38)
Location 11:21812529-21812551
Sequence AATGGATATTTTGCACTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079560299_1079560310 25 Left 1079560299 11:21812481-21812503 CCTCCCAAAGTGCTGGGATTACA No data
Right 1079560310 11:21812529-21812551 AATGGATATTTTGCACTACTTGG No data
1079560302_1079560310 21 Left 1079560302 11:21812485-21812507 CCAAAGTGCTGGGATTACAGGCG No data
Right 1079560310 11:21812529-21812551 AATGGATATTTTGCACTACTTGG No data
1079560301_1079560310 22 Left 1079560301 11:21812484-21812506 CCCAAAGTGCTGGGATTACAGGC No data
Right 1079560310 11:21812529-21812551 AATGGATATTTTGCACTACTTGG No data
1079560306_1079560310 -9 Left 1079560306 11:21812515-21812537 CCGCGCCCGCCGGGAATGGATAT No data
Right 1079560310 11:21812529-21812551 AATGGATATTTTGCACTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079560310 Original CRISPR AATGGATATTTTGCACTACT TGG Intergenic