ID: 1079564202

View in Genome Browser
Species Human (GRCh38)
Location 11:21861226-21861248
Sequence CTGGATTTTGGAGGTTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079564193_1079564202 18 Left 1079564193 11:21861185-21861207 CCTTTCAACTGAAATCTTCCAAA No data
Right 1079564202 11:21861226-21861248 CTGGATTTTGGAGGTTTTAAAGG No data
1079564198_1079564202 -5 Left 1079564198 11:21861208-21861230 CCCGGAAGGAAATCATATCTGGA No data
Right 1079564202 11:21861226-21861248 CTGGATTTTGGAGGTTTTAAAGG No data
1079564199_1079564202 -6 Left 1079564199 11:21861209-21861231 CCGGAAGGAAATCATATCTGGAT No data
Right 1079564202 11:21861226-21861248 CTGGATTTTGGAGGTTTTAAAGG No data
1079564196_1079564202 0 Left 1079564196 11:21861203-21861225 CCAAACCCGGAAGGAAATCATAT No data
Right 1079564202 11:21861226-21861248 CTGGATTTTGGAGGTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079564202 Original CRISPR CTGGATTTTGGAGGTTTTAA AGG Intergenic
No off target data available for this crispr