ID: 1079566291

View in Genome Browser
Species Human (GRCh38)
Location 11:21887411-21887433
Sequence TTCTGGTTTCAAAACAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079566291_1079566298 27 Left 1079566291 11:21887411-21887433 CCCTCTTTGTTTTGAAACCAGAA No data
Right 1079566298 11:21887461-21887483 AACCTTGAACTGCTTCTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079566291 Original CRISPR TTCTGGTTTCAAAACAAAGA GGG (reversed) Intergenic
No off target data available for this crispr