ID: 1079566292

View in Genome Browser
Species Human (GRCh38)
Location 11:21887412-21887434
Sequence CTTCTGGTTTCAAAACAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079566292_1079566298 26 Left 1079566292 11:21887412-21887434 CCTCTTTGTTTTGAAACCAGAAG No data
Right 1079566298 11:21887461-21887483 AACCTTGAACTGCTTCTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079566292 Original CRISPR CTTCTGGTTTCAAAACAAAG AGG (reversed) Intergenic
No off target data available for this crispr