ID: 1079566294

View in Genome Browser
Species Human (GRCh38)
Location 11:21887428-21887450
Sequence AAGAATTTTAAAGCTCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079566294_1079566298 10 Left 1079566294 11:21887428-21887450 CCAGAAGGAGCTTTAAAATTCTT No data
Right 1079566298 11:21887461-21887483 AACCTTGAACTGCTTCTACCAGG No data
1079566294_1079566300 17 Left 1079566294 11:21887428-21887450 CCAGAAGGAGCTTTAAAATTCTT No data
Right 1079566300 11:21887468-21887490 AACTGCTTCTACCAGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079566294 Original CRISPR AAGAATTTTAAAGCTCCTTC TGG (reversed) Intergenic
No off target data available for this crispr