ID: 1079566298

View in Genome Browser
Species Human (GRCh38)
Location 11:21887461-21887483
Sequence AACCTTGAACTGCTTCTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079566292_1079566298 26 Left 1079566292 11:21887412-21887434 CCTCTTTGTTTTGAAACCAGAAG No data
Right 1079566298 11:21887461-21887483 AACCTTGAACTGCTTCTACCAGG No data
1079566291_1079566298 27 Left 1079566291 11:21887411-21887433 CCCTCTTTGTTTTGAAACCAGAA No data
Right 1079566298 11:21887461-21887483 AACCTTGAACTGCTTCTACCAGG No data
1079566294_1079566298 10 Left 1079566294 11:21887428-21887450 CCAGAAGGAGCTTTAAAATTCTT No data
Right 1079566298 11:21887461-21887483 AACCTTGAACTGCTTCTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079566298 Original CRISPR AACCTTGAACTGCTTCTACC AGG Intergenic
No off target data available for this crispr