ID: 1079567713

View in Genome Browser
Species Human (GRCh38)
Location 11:21903099-21903121
Sequence GCATCCTGCTGAGCTGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079567713_1079567717 13 Left 1079567713 11:21903099-21903121 CCTGTACCAGCTCAGCAGGATGC No data
Right 1079567717 11:21903135-21903157 CTGTAAAAAGGTGGTAATACAGG No data
1079567713_1079567716 4 Left 1079567713 11:21903099-21903121 CCTGTACCAGCTCAGCAGGATGC No data
Right 1079567716 11:21903126-21903148 ATGATGAGTCTGTAAAAAGGTGG No data
1079567713_1079567715 1 Left 1079567713 11:21903099-21903121 CCTGTACCAGCTCAGCAGGATGC No data
Right 1079567715 11:21903123-21903145 TGTATGATGAGTCTGTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079567713 Original CRISPR GCATCCTGCTGAGCTGGTAC AGG (reversed) Intergenic
No off target data available for this crispr