ID: 1079567715

View in Genome Browser
Species Human (GRCh38)
Location 11:21903123-21903145
Sequence TGTATGATGAGTCTGTAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079567711_1079567715 14 Left 1079567711 11:21903086-21903108 CCTGCTAAACACACCTGTACCAG No data
Right 1079567715 11:21903123-21903145 TGTATGATGAGTCTGTAAAAAGG No data
1079567714_1079567715 -5 Left 1079567714 11:21903105-21903127 CCAGCTCAGCAGGATGCATGTAT No data
Right 1079567715 11:21903123-21903145 TGTATGATGAGTCTGTAAAAAGG No data
1079567713_1079567715 1 Left 1079567713 11:21903099-21903121 CCTGTACCAGCTCAGCAGGATGC No data
Right 1079567715 11:21903123-21903145 TGTATGATGAGTCTGTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079567715 Original CRISPR TGTATGATGAGTCTGTAAAA AGG Intergenic
No off target data available for this crispr