ID: 1079570949

View in Genome Browser
Species Human (GRCh38)
Location 11:21942626-21942648
Sequence CTTTATAAGCAGCATGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079570946_1079570949 7 Left 1079570946 11:21942596-21942618 CCTTTATAAATTACTCAGTCTTG 0: 129
1: 1625
2: 2722
3: 4304
4: 3741
Right 1079570949 11:21942626-21942648 CTTTATAAGCAGCATGAGAATGG No data
1079570945_1079570949 14 Left 1079570945 11:21942589-21942611 CCTCTTTCCTTTATAAATTACTC 0: 301
1: 4278
2: 8796
3: 9015
4: 8149
Right 1079570949 11:21942626-21942648 CTTTATAAGCAGCATGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079570949 Original CRISPR CTTTATAAGCAGCATGAGAA TGG Intergenic
No off target data available for this crispr