ID: 1079571123

View in Genome Browser
Species Human (GRCh38)
Location 11:21944559-21944581
Sequence GCTTCAGGTCAGTCAGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079571120_1079571123 27 Left 1079571120 11:21944509-21944531 CCTTTGATTTAATGTATTTAATT No data
Right 1079571123 11:21944559-21944581 GCTTCAGGTCAGTCAGATCCAGG No data
1079571119_1079571123 28 Left 1079571119 11:21944508-21944530 CCCTTTGATTTAATGTATTTAAT No data
Right 1079571123 11:21944559-21944581 GCTTCAGGTCAGTCAGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079571123 Original CRISPR GCTTCAGGTCAGTCAGATCC AGG Intergenic
No off target data available for this crispr