ID: 1079574470

View in Genome Browser
Species Human (GRCh38)
Location 11:21986269-21986291
Sequence TCACATCTGTTCACAGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079574468_1079574470 -9 Left 1079574468 11:21986255-21986277 CCAGAATGACCGTATCACATCTG No data
Right 1079574470 11:21986269-21986291 TCACATCTGTTCACAGATGATGG No data
1079574467_1079574470 -8 Left 1079574467 11:21986254-21986276 CCCAGAATGACCGTATCACATCT No data
Right 1079574470 11:21986269-21986291 TCACATCTGTTCACAGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079574470 Original CRISPR TCACATCTGTTCACAGATGA TGG Intergenic
No off target data available for this crispr