ID: 1079587105

View in Genome Browser
Species Human (GRCh38)
Location 11:22139664-22139686
Sequence AGCCATAATCCCAATGCGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079587095_1079587105 28 Left 1079587095 11:22139613-22139635 CCATGGTGATGGTATTAAGAGCT No data
Right 1079587105 11:22139664-22139686 AGCCATAATCCCAATGCGTTGGG No data
1079587103_1079587105 1 Left 1079587103 11:22139640-22139662 CCTTGGCTGGGCGCGGTGGCTCA 0: 166
1: 1194
2: 3855
3: 6365
4: 7730
Right 1079587105 11:22139664-22139686 AGCCATAATCCCAATGCGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079587105 Original CRISPR AGCCATAATCCCAATGCGTT GGG Intergenic
No off target data available for this crispr